Labshake search
Citations for Merck :
201 - 250 of 1582 citations for 7 Diethylamino 3 2 thienyl coumarin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of Benzonase (Merck Millipore, US170664-3) was added and samples left on ice until an aqueous solution formed (30 min to 1 h) ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (BSA, Merck/Sigma-Aldrich) in PBS was added as blocking buffer and incubated for 1 hour ...
-
bioRxiv - Developmental Biology 2024Quote: ... passed through 3 drops of Advanced KSOM (Merck) and kept for 30 minutes in a drop of KSOM (Merck ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Neuroscience 2022Quote: 6-7 dpf zebrafish larvæ were deeply anesthetized using 0.2% Ethyl3-aminobenzoate methanesulfonate (MS222; Merck KGaA, Darmstadt, Germany) diluted in EM ...
-
bioRxiv - Immunology 2024Quote: ... ∼5,000 previously anti-dinitrophenyl (DNP) IgE-sensitized lung MCs (overnight at 1 µg/ml, clone SPE-7, Merck) were washed in Tyrode buffer (Merck ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Microbiology 2023Quote: ... The remaining 32P-γ-ATP was removed by washing with 3 column volumes of Millipore water and centrifugation in 10 kDa (Qβ-RNA) or 3 kDa (8mer) Amicon filters (Merck Millipore) at 14,000 rpm at 4 °C for four times ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV titer was quantified using PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µl T4 buffer and 2 µl 50% PEG4000 (Merck, Kenilworth, NJ). After incubation ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µM epoxomicin and 50 µM (Z-LL)2-ketone (Merck Millipore) were added from stock solutions in dimethyl sulfoxide (DMSO) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% Glucose (Merck; #1.08342.1000) as liquid medium].
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% Glucose (Merck; #1.08342.1000), either as liquid medium or supplemented with 2% Agar (Roth ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2% glucose (Merck) along with 2.5% (w/v ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM CaCl2 (Merck) including sequencing grade trypsin (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... 2 (Merck, Darmstadt, Germany).
-
bioRxiv - Cell Biology 2019Quote: ... 2% PFA (103999, Merck), 2.5% gluteraldehyde (11614 ...
-
bioRxiv - Cell Biology 2019Quote: ... 2% PFA (103999, Merck), 2.5% gluteraldehyde (11614 ...
-
bioRxiv - Immunology 2021Quote: ... + 2 μL H2O2 (Merck) in 20 mL citrate buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... 2% Dabco (Merck, D27802) in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% donkey serum (Merck), 0.05% Triton-X-100 (Merck) ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.01% 2-Mercaptoethanol) (Merck) and incubated at 95°C for 10 min following a previously published protocol (Dehesh et al ...
-
bioRxiv - Immunology 2023Quote: ... rotenone (2 μM; Merck) and antimycin A (2 μM ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 2) Claret (Merck). The PKH-26 blasts were combined back with the claret LSCs and vice versa ...
-
bioRxiv - Microbiology 2023Quote: ... 2 M MgSO4 (Merck), 670 mM CaCl2 (Merck ...
-
bioRxiv - Microbiology 2023Quote: ... 2 M NaCl (Merck), 2 M KCl (Merck) ...
-
bioRxiv - Microbiology 2023Quote: ... 2 M KCl (Merck), 2 M MgSO4 (Merck) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM EGTA (Merck), and 5 mM MgCl2 (Merck ...
-
bioRxiv - Cell Biology 2023Quote: ... spermidine or MB-3 treatment, C646 (Med Chem Express, #HY-13823, USA), spermidine (Med Chem Express, #HY-B1776, USA) or MB-3 (Merck, #M2449, USA) was dissolved in DMSO (Solarbio ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... the two solutions were mixed in a 1:1 ratio and 7 drops of accelerator DMP-30 (45348, Merck) per 10 mL of Epon-mixture was added ...
-
bioRxiv - Microbiology 2023Quote: ... containing solid (7 g L−1 agar) full-strength Hoagland (2.75 mL well−1; pH adjusted to 6.5) (Sigma-Aldrich, Merck), sealed with parafilm and placed under the growth chamber ...
-
bioRxiv - Cell Biology 2020Quote: ... washed in PBS and incubated for 2 min in 2 mM H2O2 (Merck) at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... or 1% FCS (Biowest) and 2 mM CaCl2 and 2 mM MgCl2 (Merck).
-
bioRxiv - Cell Biology 2023Quote: ... or 2-deoxy-glucose (2-DG; 500 μg/g) (25972, Merck Life Sciences) were injected IP at Day 0 ...
-
bioRxiv - Neuroscience 2021Quote: ... and Pellet Paint Co-precipitant (Merck Millipore #69049-3). Genomic DNA traces were removed with DNA-free DNase Treatment and Removal Reagents (FisherScientific #AM1906 ...