Labshake search
Citations for Merck :
151 - 200 of 1582 citations for 7 Diethylamino 3 2 thienyl coumarin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck)) and kept on ice until imaging proceeded ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck)) prior to imaging.
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck). Cells were allowed to adhere on ICAM-1 coated glass slides for 10 minutes at 25°C before fixation ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck) prior to seeding the cells onto ICAM-1-coated glass-slides ...
-
bioRxiv - Cell Biology 2020Quote: ... and 1x phosphatase inhibitor 3 (Merck). Cell debris was removed by pelleting at 5000g for 10mins ...
-
bioRxiv - Immunology 2021Quote: ... 3-Methyladenine (3MA, 5mM; Merck Millipore) or Anakinra (500ng/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-mGluR2/3 (Merck Millipore), rabbit anti-CRTAC1 (Merck Millipore) ...
-
bioRxiv - Neuroscience 2019Quote: ... 3-octanol (OCT; 1:1000; Merck) and 4-methylcyclohexanol (MCH ...
-
bioRxiv - Neuroscience 2022Quote: ... primarily fixed in 3% glutaraldehyde (Merck) in 0.1 M sodium phosphate buffer with pH 7.2 at 4°C for 1 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3% bovine serum albumin (Merck). The azide-alkyne reaction was performed using the Click-iT™ Cell Reaction Buffer Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... nystatin (3 units/ml) (Merck: N1638) and ascorbic acid (500 μM ...
-
bioRxiv - Developmental Biology 2023Quote: ... or 3% Rabbit Serum (R9133, Merck)) and finally applying the conjugated antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (Merck; UK 28718-90-3) was included as a final wash stage ...
-
bioRxiv - Physiology 2024Quote: ... - 3% horse serum (Merck, ref H1270) PBS solution for 1 h ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 units/ ml nystatin (Merck: N1638) and 20 mM HEPES ...
-
bioRxiv - Biophysics 2020Quote: ... Dead cells were removed on day 7 prior to splitting by Ficoll-Paque Plus (Merck) step gradient centrifugation and cytotoxic T lymphocytes (CTLs ...
-
bioRxiv - Microbiology 2021Quote: ... washed with 0.1 M PIPES buffer pH 7 (Merck Life Science UK Limited, Dorset, UK), and fixed with 2.5% glutaraldehyde in cacodylate buffer (Merck Life Science UK Limited ...
-
bioRxiv - Cell Biology 2023Quote: ... the reducing agent 2 µl 2-picoline borane complex (PB, 2 M in DMSO, Merck) and 2 µl water ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluates 1-3 were mixed and concentrated with Amicon Ultra-15 (Merck Millipore, MWCO 3 K) to protein concentrations of 44–162 µM.
-
bioRxiv - Genomics 2023Quote: ... then immersed in an amino-silane solution (3% vol/vol (3-aminopropyl) triethoxysilane (Merck cat no. 440140), 5% vol/vol acetic acid (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (all Merck). The pH was adjusted to 7.3-7.4 (S20 ...
-
bioRxiv - Biophysics 2023Quote: ... 2-aminoethoxydiphenyl borate (2-APB) (Sigma-Aldrich/Merck, Germany), BL-1249 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 72 hrs or 7 days after adding the drugs organoids were fixed with 4% PFA (Merck) and stained with Hoechst (Invitrogen) ...
-
bioRxiv - Immunology 2022Quote: 7 weeks old mice were injected intraperitoneally with 10 mg/kg body weight Azoxymethane (AOM, Merck), dissolved in isotonic saline solution ...
-
bioRxiv - Plant Biology 2023Quote: ... while 4-chloro-7-nitrobenzoxadiazole (NBD-Cl, 97%, Sigma-Aldrich, Merck Group, St Louis, MO, USA) was applied at 270LgLha−1 of active ingredient ...
-
bioRxiv - Immunology 2023Quote: ... and perfringens Types C and D (Vision 7 with SPUR, Merck Animal Health; Madison, NJ, USA). The cattle were also treated with fenbendazole (SafeGuard ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... was washed 3 times with PBS (Merck Millipore ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... 3-Indoleacetic acid (IAA, auxin) (Merck, I2886) and 1-Naphthaleneacetic acid (NAA ...
-
bioRxiv - Neuroscience 2020Quote: ... were primarily fixed in 3% glutaraldehyde (Merck) in 0.1 M sodium phosphate buffer with pH 7.2 at 4°C for 1 h and stored in a 0.1 M Na-phosphate buffer at 4°C until further analysis ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 3% sucrose (Merck KGaA; type number: 107687), and 30% apple juice (Edeka ...
-
bioRxiv - Immunology 2020Quote: ... Cells were fixed with 3% paraformaldehyde (Merck) and stained with anti-perforin Ab and phalloidin-AF 488 ...
-
bioRxiv - Immunology 2022Quote: ... Benzonase (15 U; Merck Millipore, 70664-3) and nuclease-free water served as positive and negative control ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µg of calf histones (Merck; H9250) was added ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Cell Biology 2022Quote: IBMX (3-Isobutyl-1-Methylxanthin – 15879 - Merck) and lidocaine (L7757 – Merck ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
Class IIa HDACs inhibit cell death pathways and protect muscle integrity in response to lipotoxicitybioRxiv - Cell Biology 2023Quote: ... 1S,3R-RSL 3 (Merck, Melbourne, Australia) and Ferrostatin (Selleckchem ...
-
bioRxiv - Genomics 2024Quote: ... scaffold and 3’-extensions (IDT or Merck). The pegRNA acceptor plasmid (Addgene #132777 ...
-
bioRxiv - Cell Biology 2019Quote: ... 2% peptone (Becton Dickinson) and 2% glucose (Merck, Darmstadt, Germany). SC consisted of 0.7% yeast nitrogen base (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... 2% peptone (Becton Dickinson) and 2% glucose (Merck, Darmstadt, Germany). SCD-MSG medium consisted of 0.17% yeast nitrogen base without amino acids and ammonium sulfate (Formedium ...
-
bioRxiv - Microbiology 2023Quote: ... IL-2 (Merck), JQ-1 (Sigma Aldrich) ...
-
bioRxiv - Plant Biology 2021Quote: ... Individual sporophytes were subsequently transferred to GA-7 Magenta boxes (Merck Life Science UK Ltd., Dorset, UK) containing 100ml C-fern agar media when two fronds were visible (10-14 days old) ...
-
bioRxiv - Neuroscience 2022Quote: ... They were recorded in the presence of 10 mM CNQX (6-cyano-7-nitroquinoxaline-2,3-dione, Merck) and 50 mM D-AP5 (D-2-amino-5-phosphonovalerate ...
-
bioRxiv - Genomics 2023Quote: ... All sections from each sample were homogenised using a 7 ml glass Dounce tissue grinder set (Merck) with 8–10 strokes of a loose pestle (A ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 4.2) and 4-methylumbelliferyl-2-acetamido-2-deoxy-b-D-glucopyranoside (2 mM; #474502, Sigma-Aldrich/Merck). The reaction was stopped by 5 volumes of glycine and Na2CO3 ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...