Labshake search
Citations for Merck :
201 - 250 of 1850 citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and 3-NT (1:1000, 06-284, Merck) were used ...
-
bioRxiv - Neuroscience 2024Quote: ... or 3-NT (1:1000; 06-284, Merck). Following primary antibody incubation ...
-
bioRxiv - Plant Biology 2024Quote: ... protoplasts were treated with 3 µM DAPI (Merck) overnight ...
-
bioRxiv - Microbiology 2024Quote: ... 3 rounds of phenol-chloroform-isoamyl alcohol (Merck) extraction were performed using 15 ml gel-lock tubes (QIAGEN) ...
-
bioRxiv - Cancer Biology 2022Quote: D-(+)-glucose (product number G7021) and D-glucose-1,2,3,4,5,6,6-d7 (product number 552003) were purchased from MERCK.
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-total-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (anti-tAMPAR) (Cat.#AB1504, Merck Millipore, Burlington, MA, USA), anti-phospho (Ser845)-AMPAR (anti-pAMPAR;cat.#AB5849 ...
-
bioRxiv - Microbiology 2024Quote: ... hsa-miR-21-5p scramble microRNA mimic and a double-stranded small RNA oligonucleotide control (sequence: 5’- GGAACGCCAACCGAAGUCUA - 3’) (all from Merck) were added to achieve a final concentration of 250 nM on each well ...
-
bioRxiv - Biochemistry 2024Quote: Lipids (1 mg from the brain and 3–5 mg from the testis) were separated via TLC (Silica Gel 60 TLC plate, Merck) with methyl acetate/2-propanol/chloroform/methanol/0.25% calcium chloride in water (25:25:25:10:9 ...
-
bioRxiv - Cancer Biology 2024Quote: ... at a multiplicity of infection (MOI) of 2–3 in the presence of 5 µg/ml polybrene (Hexadimethrine bromide, Merck). For creating stable SCC13 cell lines expressing YAP- or TAZ-targeting shRNAs ...
-
bioRxiv - Microbiology 2023Quote: ... The remaining 32P-γ-ATP was removed by washing with 3 column volumes of Millipore water and centrifugation in 10 kDa (Qβ-RNA) or 3 kDa (8mer) Amicon filters (Merck Millipore) at 14,000 rpm at 4 °C for four times ...
-
bioRxiv - Microbiology 2024Quote: ... The chromatic mutants were mixed in different ratios (1:1, 1:3, 3:1) and the mixtures were fixed using 4% paraformaldehyde (Sigma−Aldrich/Merck, Germany) for 4 h at 4°C.
-
bioRxiv - Neuroscience 2024Quote: ... The medium was then collected and filtered with a 3 kDa filter (Amicon Ultra-4 centrifugal Filter 3 kDa MWCO, Merck UFC8003243). Five distinct preparations of ACS <3kDa were prepared from five astrocytes cultures and were then sent to the Protein Analysis Facility of the University of Lausanne for Mass Spectrometry analysis.
-
bioRxiv - Cell Biology 2024Quote: ... the protein solution was centrifuged at 16,000 g for 30 minutes with a 3 kD cut-off filter (Amicon Ultra Centrifugal Filter, 3 kDa MWCO, Merck Millipore) to remove previous buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... and/or with plasmid DNA (e.g. 1µg/well for 6-well plates) for 24 hrs using GeneJuice (Merck Millipore). siRNAs targeting USP7 ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were cultured on poly-L-ornithine and laminin-coated coverslips in 24-well plates at 150,000 cells per well in serum-free 2i Medium (Merck). After 24h ...
-
bioRxiv - Neuroscience 2022Quote: ... were incubated for 24 hours in blocking buffer containing 10% (vol/vol) normal donkey serum (NDS) (S30-100ML, Merck), 0.5% (vol/vol ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated for 24 h at +4°C with primary antibodies (goat anti-Chat (1:200, Merck, AB144P), mouse anti-GFAP (1:300 ...
-
bioRxiv - Biophysics 2024Quote: ... Total DNA was extracted by adding 1 mL of a 25:24:1 phenol:chloroform:isoamyl alcohol mixture (Merck, Darmstadt, Germany) along with 1 g of acid washed glass beads (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... Trans-well experiments were performed as described above in 24 well plates using inserts with a 0.4 µm pore size (Merck). In order to assess host cell susceptibility to small pore forming toxins ...
-
bioRxiv - Neuroscience 2021Quote: Aldicarb and paraoxon-ethyl were acquired from Merck. Aldicarb was dissolved in 70% ethanol and paraoxon-ethyl was dissolved in 100% DMSO ...
-
bioRxiv - Cell Biology 2023Quote: ... spermidine or MB-3 treatment, C646 (Med Chem Express, #HY-13823, USA), spermidine (Med Chem Express, #HY-B1776, USA) or MB-3 (Merck, #M2449, USA) was dissolved in DMSO (Solarbio ...
-
bioRxiv - Biophysics 2023Quote: 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphocholine (DOPC) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) stored in chloroform were purchased from Merck (Darmstadt, Germany) and stored under argon ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...
-
bioRxiv - Cell Biology 2023Quote: ... P1 virus was used to infect 50 ml of SF9 culture and P2 virus was harvested after 3-5 days through centrifugation and subsequent filtration through 0.45 μm PVDF membrane (Merck Millipore, SLHV033RS). P2 virus was either propagated further or stored at 4ºC in the dark ...
-
bioRxiv - Molecular Biology 2024Quote: ... 200 μl of Protein powder solutions (1 mg/ml) were added to 3 cm NG plates with 10 µM 5-FU (Merck, #F6627). After the plates had dried ...
-
bioRxiv - Bioengineering 2024Quote: ... or 3-5×105 pelleted cells were lysed in TRI Reagent (“LS” for fluid EV samples, conventional for cells, Merck Millipore). Liquid chloroform was added to the lysates at a 1:5 v/v ratio and vigorously mixed for 30 s ...
-
bioRxiv - Cell Biology 2022Quote: ... 80 μM o-phenantroline (Merck, 131377), 1.5 μM pepstatin A (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... 80 μM o-phenantroline (Merck,131,377), 1.5 μM pepstatin A (Merck ...
-
bioRxiv - Pathology 2023Quote: ... Oil Red O (Sigma-Merck, Germany) dye was used for staining lipids ...
-
bioRxiv - Neuroscience 2021Quote: ... and Pellet Paint Co-precipitant (Merck Millipore #69049-3). Genomic DNA traces were removed with DNA-free DNase Treatment and Removal Reagents (FisherScientific #AM1906 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1 M 3-Isobutyl-1-methylxanthine (IBMX; Merck, 15679), 50 mM DAPT (Merck ...
-
bioRxiv - Biochemistry 2020Quote: ... using 3 kDa MWCO Amicon centrifugal filters (Merck Millipore). For protein denaturation ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), and interleukin 1β (IL1β ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), interleukin 1β (IL1β ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3 µM IWR-1 (MERCK, Cat. no. 681669). Glasgow’s MEM (GMEM)-based (Gibco ...
-
bioRxiv - Molecular Biology 2023Quote: ... the anti-S tag antibody (Merck, Cat# 71549-3) was added directly to the medium of each well resulting in a final dilution of 1:500 ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001)) ...
-
bioRxiv - Neuroscience 2023Quote: ... and incubated with Benzonase Nuclease (Merck Millipore, US170664-3) for 30 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:100 Phosphatase Inhibitor cocktail 3 (Merck, P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 3-HA were purchased from Merck (Sigma-Aldrich). For L-kynurenine and kynurenic acid ...
-
bioRxiv - Genomics 2022Quote: ... and subsequently blocked in 3% BSA (A8022, Sigma/Merck) in 1x PBS-Tween (137 mM NaCl ...
-
bioRxiv - Plant Biology 2023Quote: ... using a 3 kDa MWCO Amicon centrifugal concentrator (Merck) and the N-terminal His6-tag cleaved with Human Rhinovirus 3C protease at 4°C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 × 3 min Neo-Clear (Cat. No. 1.09843, Merck), 2 × 3 min 100% ethanol ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.1 M 3-Isobutyl-1-methylxanthine (IBMX; Merck, 15679), 50 mM DAPT (Merck ...