Labshake search
Citations for Merck :
1 - 50 of 1850 citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 400 ng of D7-24S-hydroxycholesterol (D7-24S-OHC) (Avantipolar Lipids) and 100 µg of epicoprostanol (Sigma-Merck) as internal standards ...
-
bioRxiv - Bioengineering 2021Quote: Three sender area squares (3 × 3 mm) were put into a 24-well containing 300 μL of anti-His antibody (Merck, Germany, NOVG70796-3) (10 μg mL−1 in DPBS ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were derivatized for 1 hour at 85 °C using N-tert-Butyldimethylsilyl-N-methyl-trifluroacetamide with 1% tert-Butyldimethylchlorosilane (Merck, NJ, USA) and immediately analysed by GC-MS ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by signal development for 6–24 h in a solution containing nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Merck). The samples were covered with glass coverslips using CC/Mount (Merck) ...
-
bioRxiv - Genomics 2024Quote: ... Traps deployed by BCC were also baited with 1-octen-3-ol (Merck Life Science, Bayswater, Australia) (van Essen et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... 24×50 mm high-precision coverslips (no. 1.5H; Marienfeld) were cleaned in Piranha solution (3:1, 98% H2SO4 (Merck):30% H2O2 (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... namely using 1 g/L MS-222 (Ethyl 3-aminobenzoate methanesulfonate, Merck #E10521) and subsequent exsanguination by cutting the gill arches ...
-
bioRxiv - Biophysics 2020Quote: ... 105 cells were seeded on the upper chamber of 24 well plate cell culture inserts containing 3 µm pores (Cat # 353096, Merck). The inserts were coated with rat-tail collagen I ...
-
bioRxiv - Genetics 2021Quote: In vitro treatments were carried out with different compounds: 1 μM MG-132 24 hours or 3 hours (Merck Millipore), 20 μM Chloroquine (CQ ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.04 mM adenine (Merck/Sigma-Aldrich, CAS number : 73-24-5), 0.04 mM cytosine (Merck/Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 × 105 cells were seeded on the upper chamber of 24 well plate cell culture inserts containing 3 μm pores (Merck, Cat # 353096) coated with rat-tail collagen I (Sigma ...
-
bioRxiv - Plant Biology 2024Quote: ... A standard curve was prepared using cyanidin-3-O-glucoside (Merck KGaA, Darmstadt, Germany) for calculating Anth content per unit leaf FW.
-
bioRxiv - Plant Biology 2024Quote: ... A standard curve was prepared using cyanidin-3-O-glucoside (Merck KGaA, Darmstadt, Germany) for calculating relative Anth content per unit leaf biomass (mg/g FW).
-
bioRxiv - Bioengineering 2024Quote: ... We then dissolved 100 μmol of N-ethyl-N’-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC, Merck, E7750) in 1 mL of MES buffer and added it to the beaker ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... 24 μg/ml insulin (Merck, I6634), 10% FBS (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: 24-well transwell plates (Merck, CLS3470) were coated with Matrigel (Corning ...
-
bioRxiv - Developmental Biology 2022Quote: ... by submersion in 160 mg/l MS-222 (ethyl 3-aminobenzoate methanesulfonate; Sigma-Aldrich, Merck, Darmstadt, Germany) dissolved in tank water ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Neuroscience 2022Quote: ... LPS (100 ng/mL, 24 h, Merck) or IL-4 (20 ng/mL ...
-
bioRxiv - Neuroscience 2022Quote: ... LPS (100 ng/mL, 24 h, Merck), IL-4 (20 ng/mL ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Evolutionary Biology 2022Quote: ... normal (24 h) and low pH (24 h) cultures were filtered using a 0.22 μm PVDF filter (Merck Millipore, Germany). These samples were loaded onto an OnGuard column (Dionex OnGuard II Cartridge ...
-
bioRxiv - Biophysics 2020Quote: ... Digitonin was from Merck (CAS 11024-24-1). PolyU potassium salt (800 kDa ...
-
bioRxiv - Genetics 2021Quote: ... 20 μM Chloroquine (CQ) 24 hours (Merck Millipore) or together (0.25 μM MG-132 + 10 μM CQ ...
-
bioRxiv - Immunology 2024Quote: ... and 50µM β-mercaptoethanol (Merck, 60-24-2). For the proliferation assay ...
-
bioRxiv - Evolutionary Biology 2020Quote: Larvae were raised as described above until 11 dpf and deeply anesthetized with 160 mg/l of Tricaine (Ethyl 3-aminobenzoate methanesulfonate salt, MS-222, Merck) before dissecting their pectoral fins ...
-
bioRxiv - Developmental Biology 2023Quote: ... Product number E4250) (1 mg/ml) to contract pigment cells alongside 0.01% Tricaine (Ethyl 3-aminobenzoate methanesulfonate, Sigma-Aldrich (Merck) Product number E10521 ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA oligonucleotide G4A4 (5’-AAAAAAGGGGAAAAGGGGAAAAGGGGAAAAGGGGAAAAAA-3’) was purchased from Merck. CD analysis of 2,5 µM RNA was carried out in the buffer used for G4-pulldown ...
-
bioRxiv - Neuroscience 2022Quote: ... was combined with 90μM sygRNA (5’ - GGATTTGGTAATAGCAG AGGGGG 3’) (Merck) at RT for 15 minutes to form an RNP complex ...
-
bioRxiv - Cell Biology 2023Quote: ... for 24 hours or with mimosine (0,5mM, Merck Millipore)/aphidicolin (400nM ...
-
bioRxiv - Neuroscience 2022Quote: ... microglia were treated with vehicle (PBS, 24 h, Merck), LPS (100 ng/mL ...
-
bioRxiv - Plant Biology 2024Quote: ... phenol:chloroform:isoamyl alcohol 25:24:1 (Sigma-Aldrich, Merck, Germany) extraction was performed ...
-
bioRxiv - Physiology 2024Quote: ... in 24-well culture plates (Corning, Merck, Darmstadt, Germany) in a density of 150000 cells/well ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM GSK-3 Inhibitor XVI (Merck, 361559) and 0.8 μM PD184352 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... or 24 well polystyrene plates (Corning®Costar® Merck) containing TAP or Tris minimal medium (The Chlamydomonas Sourcebook ...