Labshake search
Citations for Merck :
201 - 250 of 2804 citations for 2 Amino 3 chloro 5 nitro 6 picoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: Cytotoxicity of the compounds were tested by use of a MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay (Merck) at a final MTT concentration of 0.45 mg/ml or by use of a ATPlite Luminescence Assay System (PerkinElmer ...
-
bioRxiv - Molecular Biology 2023Quote: Cells of 2-3 days growth with approximately 70-90% confluency have been treated with Bortezomib (Merck, #504314) at 100 nM for 42 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Biochemistry 2021Quote: All amino acids and resins were purchased from Novabiochem (Merck, Darmstadt, Germany) and Carbosynth (Compton ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2X of basal medium eagle’s amino acids solution 50X (Merck, Darmstadt, Germany) and 1X of minimal essential medium nonessential amino acid solution 100X (Merck) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 1X of minimal essential medium nonessential amino acid solution 100X (Merck). For culture of embryos with exogenous FGF4 ...
-
bioRxiv - Immunology 2023Quote: ... amino acids (10 mM glutamine, asparagine or aspartic acid – all from Merck), or D-glucose (50 mM ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Rink amide MBHA resin and Fmoc-protected amino were purchased from Merck. SPPS was performed on a Liberty Blue automated peptide synthesizer (CEM ...
-
bioRxiv - Cancer Biology 2020Quote: ... media was replaced with media containing 10 nM 5-Bromo-2′-deoxyuridine (BrdU) (Merck, B5002-100MG). Coverslips were then fixed ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM GSK-3 Inhibitor XVI (Merck, 361559) and 0.8 μM PD184352 (Sigma-Aldrich ...
-
bioRxiv - Immunology 2020Quote: Survival was determined by assessing the fraction of vital cells at defined time points during culture by flow cytometric exclusion of 4’,6-Diamidin-2-phenylindol (DAPI) (Merck, Darmstadt, Germany) and Annexin V-APC (BD Biosciences ...
-
bioRxiv - Cancer Biology 2024Quote: ... and incubated under 365 nm UV-light for 15 min with 666 µg sulfosuccinimidyl 6-(4-azido-2-nitrophenylamino)hexanoate (sulfo-SANPAH, Sigma-Aldrich, Merck, 803332) diluted in 10 mL sterile dH2O ...
-
bioRxiv - Cancer Biology 2021Quote: ... α6-integrin (Merck, monoclonal, MAB1378), Laminin V (Merck ...
-
bioRxiv - Developmental Biology 2023Quote: ... 6% PEG 4000 (Merck-Schuchardt), pH 5.0 ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Microbiology 2024Quote: ... hsa-miR-21-5p scramble microRNA mimic and a double-stranded small RNA oligonucleotide control (sequence: 5’- GGAACGCCAACCGAAGUCUA - 3’) (all from Merck) were added to achieve a final concentration of 250 nM on each well ...
-
bioRxiv - Biochemistry 2024Quote: Lipids (1 mg from the brain and 3–5 mg from the testis) were separated via TLC (Silica Gel 60 TLC plate, Merck) with methyl acetate/2-propanol/chloroform/methanol/0.25% calcium chloride in water (25:25:25:10:9 ...
-
bioRxiv - Neuroscience 2020Quote: The cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 μL of each sample was injected into a Chromolith FastGradient RP 18-e column (50 x 3 x 2 mm; monolithic silica with bimodal pore structure, macropores with 1.6mm diameter; Merck) protected by a precolumn (Gemini NX RP18 ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of the bacteriocin sample was loaded onto the trap column at 3% (v/v) ACN (Merck, USA) containing 0.1% (v/v ...
-
bioRxiv - Neuroscience 2022Quote: ... The PDMS microstructures were then rinsed with 2:3 HEPES1/ethanol and with ultrapure water (Milli-Q, Merck-MilliPore). PVP (1.3 MDa ...
-
bioRxiv - Neuroscience 2024Quote: ... for 180 min prior to washing and development in Streptavidin-tertiary reagent (1:500 in 2% BSA and 0.1% Triton [TBS]) conjugated to either Cyanine 3 (Cy3) (Merck) or Alexa Fluor 488 (Life technologies ...
-
bioRxiv - Immunology 2023Quote: ... the mice were intranasally sensitized using 1 μg of 2′3′-cyclic GMP-AMP (cGAMP, 531889; Merck Darmstadt, Germany) and 1 μg of (HDM ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 × 106 CGNs were mixed with 2 μg of a Mission shRNA vector for Snph (TRCN0000201959, Merck, Darmstadt, Germany) or pLKO.1-TRC-control (Addgene_#10879 ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells at a density of 5×105 /ml were supplemented with 2% dimethyl sulfoxide (DMSO; Merck) and the culturing was continued for another 24 to 72 hr ...
-
bioRxiv - Bioengineering 2022Quote: ... Five μL of the sample were injected into a C18 column (Merck Spherisorb ODS-2 (5 μm), 250×4 mm ...
-
bioRxiv - Plant Biology 2023Quote: ... pericarp sections were incubated for 2 h in a 5% (v/v) Normal Donkey serum (NDS; Merck) blocking solution in MTSB ...
-
bioRxiv - Neuroscience 2021Quote: ... 10mM Hepes and 1% MEM amino acids (all obtained from Merck, Darmstadt, Germany). Cells were grown for two weeks ...
-
bioRxiv - Developmental Biology 2022Quote: ... MII oocytes were activated for 6 h in Ca-free α-MEM medium containing 10 mM SrCl2 and 5 μM Latrunculin B (cat. no. 428020, Merck Millipore, Darmstadt, Germany). Following activation ...
-
bioRxiv - Molecular Biology 2021Quote: ... washed and resuspended in PBS and measured by flow cytometry (FACS) using the Guava Easy Cyte 6-2 L system (Merck Millipore, Schwalbach, Germany). Fluorescence was excited at 488nm and BODIPY emission was recorded at 530 and 585 nm ...
-
bioRxiv - Molecular Biology 2021Quote: ... Apoptotic cell death was detected by annexin-V/propidium iodide staining and subsequent flow cytometry analysis using the Guava Easy Cyte 6-2 L system (Merck Millipore, Schwalbach, Germany). Annexin-V-FITC emission was detected with the green filter at 525/530 nm ...
-
bioRxiv - Cell Biology 2021Quote: ... were applied for one hour at room temperature and cells were counterstained with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI; Merck G8294; 1:3000) before mounting with Fluoromount™.
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...
-
bioRxiv - Cell Biology 2023Quote: ... P1 virus was used to infect 50 ml of SF9 culture and P2 virus was harvested after 3-5 days through centrifugation and subsequent filtration through 0.45 μm PVDF membrane (Merck Millipore, SLHV033RS). P2 virus was either propagated further or stored at 4ºC in the dark ...
-
bioRxiv - Molecular Biology 2024Quote: ... 200 μl of Protein powder solutions (1 mg/ml) were added to 3 cm NG plates with 10 µM 5-FU (Merck, #F6627). After the plates had dried ...
-
bioRxiv - Bioengineering 2024Quote: ... or 3-5×105 pelleted cells were lysed in TRI Reagent (“LS” for fluid EV samples, conventional for cells, Merck Millipore). Liquid chloroform was added to the lysates at a 1:5 v/v ratio and vigorously mixed for 30 s ...
-
bioRxiv - Immunology 2021Quote: ... was mixed 1:1 and incubated at RT for 2-3 min or ECL substrate is added (Immobilon crescendo western HRP substrate, WBLUR0100, Merck). Membranes were then exposed to film and developed or visualised by chemiluminescence using the G:BOX Chemi gel doc Imaging System Instrument (Syngene) ...
-
bioRxiv - Neuroscience 2021Quote: Viability of SH-SY5Y cells after treatments with or without H-LIPEF was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Neuroscience 2020Quote: ... They were cut into 250μm parasagittal slices using a McIlwain tissue chopper and the slices placed on Millicell membrane (3-4 slices per membrane, 2 membranes per animal, 0.4 μm Millicell, Merck Millipore) in 50% BME (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2022Quote: ... The purified proteins were concentrated to 2 mg/mL using centrifugal filters with either 3 kDa or 30 kDa cut-off (Amicon Ultra-0.5, Merck/Millipore) and the samples were centrifuged at 100,000 g ...
-
bioRxiv - Genetics 2021Quote: ... At day 10 cells were passaged at a 2:3 ratio into 12 well cell culture plates coated with 15 µg/ml human plasma fibronectin (Merck) in Dulbecco’s phosphate-buffered saline (DPBS ...
-
bioRxiv - Neuroscience 2024Quote: ... animals at the age of 3 months were perfused using 2% Formaldehyde (Science Services, München, Germany) and 2.5% Glutaraldehyde (Merck, Darmstadt, Germany) in 0.1M Cacodylate buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... the beads were washed 3 more times with 100 µL lysis buffer 2 supplemented with 100 µg/mL polyU RNA (Merck). The bound complexes were eluted in lysis buffer 2 containing 25 mM glutathione or 5 mM biotin (Merck) ...
-
bioRxiv - Microbiology 2023Quote: ... were pre-prepared by washing 3 times in immunoprecipitation buffer then resuspended in 200μl immunoprecipitation buffer and coated with 2 μl FLAG M2 (Merck Millipore) or IgG (Merck Millipore ...
-
bioRxiv - Pathology 2023Quote: ... To prevent unspecific labelling the sections were incubated for 2 × 10 minutes in PB solution containing 3% hydrogen peroxide (Merck Life Science AS/Sigma Aldrich Norway AS ...