Labshake search
Citations for Merck :
151 - 200 of 2804 citations for 2 Amino 3 chloro 5 nitro 6 picoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). Antigen retrieval methods have been previously described 128 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 x 5 mins in PBS with 0.2% Triton X-100 (Merck, T8787) and 0.2% BSA (PBT ...
-
bioRxiv - Microbiology 2020Quote: ... In the first tube, 6 ml of amniotic fluid was dissolved in 3 ml of glycerol (≥99 %, G2025, Sigma-Aldrich (Merck), Overijse ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviral transductions were performed in a 6-well plate format (3 × 105 cells/well) using 10 µg/mL polybrene (Merck Millipore). Stably transduced cells were flow-sorted.
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated for 10 minutes in 4’,6-diamidino-2-phenylindole (DAPI; 1:10,000, Merck, Italy, D9542), to allow visualization of cell nuclei ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 mM K4Fe(CN)6 and 1 mg/ml X-gal (Roth)) and counterstained with nuclear fast red (Merck) for 5 min ...
-
bioRxiv - Immunology 2020Quote: ... Amino acids were obtained from Novabiochem (Merck KGaA, Darmstadt, Germany). Peptides were purified using reverse phase preparative high-performance liquid chromatography (HPLC ...
-
bioRxiv - Immunology 2020Quote: ... Amino acids were purchased from Novabiochem (Merck KGaA, Darmstadt, Germany). N ...
-
bioRxiv - Developmental Biology 2022Quote: ... 32.8 mM 20:4 and 60 mM 22:6) and pipetted dropwise into N2 media containing 3 mM fatty acid-free BSA (Merck, Cat. #A8806) at 37°C with constant stirring to obtain final concentrations of 3 mM 18:0 ...
-
bioRxiv - Biophysics 2021Quote: ... Cells at 2-3 x 106 cells/mL were induced with 50 ng/mL doxycycline (Merck) and 5 mM valproic acid (Cayman Chemical) ...
-
bioRxiv - Immunology 2020Quote: ... 2-3 × 105 cells/well were plated in an ELI Spot plate (MAHAS4510, Merck Millipore, USA) and in vitro cultured for 18-24 hours in media supplemented with or without peptide at 0.5 µM (or ...
-
bioRxiv - Biochemistry 2020Quote: ... then supernatant concentrated to 2 mL using 3 kDa Amicon Ultra-15 Centrifugal Filter Units (Merck). Supernatant was then washed 3 times with 15 mL 10 mM ammonium acetate to remove residual erythromycin ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 3-(3,5-dioxo-1,2,4-oxadiazolidin-2-yl)-L-alanine (quisqualate) was purchased from Merck (Darmstadt, Germany). AF647-conjugated 9E10 antibody was prepared in-house as described previously (Cook et al. ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Cell Biology 2022Quote: Depletion of Cav1 was achieved by RNAi using siRNAs with the following sequence: 5’ GCAUCAACUUGCAGAAAGA 3’ (Merck), and Control siRNA Luciferase ...
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated with the nucleus DNA stain 4′,6-diamidino-2-phenylindole (DAPI) (1μg/ml D9542-10MG, Merck Life Science UK Ltd ...
-
bioRxiv - Microbiology 2023Quote: ... LB plates were seeded with the different cultures and Whatman n° 1 filter discs (6 mm) were impregnated with 5 μl of 30% (v/v) H2O2 (Merck) as previously described [31] ...
-
bioRxiv - Microbiology 2024Quote: ... One-centimeter length of colon was homogenized (50 mg/mL) in ice-cold 50mM potassium phosphate buffer (pH 6) containing 5% hexadecyl trimethyl ammonium bromide (Merck) and hydrogen peroxide (0.0005%) ...
-
bioRxiv - Developmental Biology 2022Quote: ... embryos were initially incubated with 100 µM EdU (5-ethynyl-2’-deoxyuridine) (Merck, T511285) for 1 h before washing and fixation ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse monoclonal anti-α-tubulin clone B-5-1-2 (Merck T5168; 1:5000), mouse monoclonal anti-EF-18 clone A-5 (Santa Cruz Biotechnology sc-393731 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The staining of the precipitated polypeptide-antibody complexes was performed by addition of 60 mg 4-chloro-1 naphtol (Merck/Sigma-Aldrich; Cat#C8890) in 20 ml ice-cold methanol to 100 ml phosphate buffered saline (PBS ...
-
bioRxiv - Physiology 2023Quote: ... Samples were separated on a SeQuant ZIC-pHILIC column (100 3 2.1 mm, 5 mm, polymer, Merck-Millipore) including a ZIC-pHILIC guard column (2.1 mm x 20 mm ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were washed 3 times with PBS-T for 5 min and incubated with mouse-HRP (A4416; Merck) and rabbit-HRP (GENA9640V ...
-
bioRxiv - Physiology 2024Quote: ... 5 min incubation at room temperature with 100 µL 1-Bromo-3-chloropropane (BCP) (Merck, Darmstadt, Germany, #B9673) was performed ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... excess media was removed from wells and mf were incubated with 0.5 mg/ml MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (Merck) in PBS at 37°C for 90 min ...
-
bioRxiv - Cancer Biology 2021Quote: Cell proliferation was assessed by 3-(4,5-1,2methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Merck Millipore). K562 cells (5,000/well ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... dried tissue samples (in liquid nitrogen) were dissolved in 3:2:1 mixture of HNO3 (Merck, Germany), H2SO4 (Merck ...
-
bioRxiv - Plant Biology 2024Quote: ... patens grown on PpNH4 were homogenized in 2 mL tubes using 3-mm zirconium glass beads (Merck) in presence of 500 µL of cold TEN buffer (Tris-HCl 100 mM ...
-
bioRxiv - Biochemistry 2022Quote: ... supplemented with 1% MEM Non-Essential Amino Acid Solution (Merck: M7145), 1 mM sodium pyruvate (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... The acquired data quality was monitored by Amino Acid standards (Merck, Sigma-Aldrich Production GmbH ...
-
bioRxiv - Biochemistry 2024Quote: ... 67 g/L Yeast Nitrogen Base Without Amino Acids (Merck #Y0626)) supplemented with 3% Glucose ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5×105 cells were grown until confluence in 0.2 mg/ml collagen-type I-coated 6 well plates (Merck, Darmstadt, Germany) and incubated in serum-free medium for 24 h with/without Dox treatment ...
-
bioRxiv - Neuroscience 2022Quote: ... Following counterstaining with 4’,6-diamidino-2-phenylindole (DAPI; Vectashield/Biozol) slices were mounted in Mowiol 4-88 (Merck Chemicals).
-
bioRxiv - Cell Biology 2023Quote: ... we seeded cells at 2 * 106 cells/ mL in S2 media in 2 mL media/ well in a 6-well plate with either DMSO (D2650, Merck), 2.5 μM CytD (C2618 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were then plated at a density of 500 cells/cm2 into 6-well plates coated with 1.2% poly(2-hydroxyethylmethacrylate) (Merck, Germany) in 95% ethanol (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: ... and a SeQuant ZIC-HILIC precolumn (5 μm particles, 20 × 2 mm) (Merck, Darmstadt, Germany) using a linear gradient of mobile phase A (5 mM NH4OAc in acetonitrile/H2O (5/95 ...
-
bioRxiv - Immunology 2022Quote: ... Peritoneal cavity cells were obtained by lavage with 5 mL PBS + 2 mM EDTA (Merck). Following gentle massage ...
-
bioRxiv - Biochemistry 2024Quote: ... After 2 days incubating with 5 μM ROCK Inhibitor (Y-27632, RI, from Merck Millipore), 40 μM TGF-β inhibitor (SB 431524 ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 mM sodium ascorbate) on ice and filtered through 2 layers of Miracloth (Merck Millipore). Intact chloroplasts were collected from a band at the interface between the 40 % (v/v ...
-
bioRxiv - Cell Biology 2022Quote: ... 6 M urea (Merck), 1% sodium dodecyl sulfate (SDS ...
-
bioRxiv - Neuroscience 2020Quote: ... pH 7.4) (final concentration: 12mg/mL) containing 5 μL Benzonase (final concentration: 1 μL benzonase/mL (MERCK, 71205-3). After dissolving ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked for 3 hr in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were permeabilized with 0.1% Triton X-100 for 3 minutes and then blocked with 5 or 10% bovine serum albumin (BSA, Merck) in PBS for 20 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked for 3 hours in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (TBST ...
-
bioRxiv - Cancer Biology 2024Quote: ... each coverslip was washed with PBS 3 times each for 5 minutes and nuclei were stained with Hoechst (Merck Sigma ...
-
bioRxiv - Biophysics 2022Quote: The dyes used in this study and the working dilutions were: 6-Dodecanoyl-N,N-dimethyl-2-naphthylamine (LAURDAN, 4.5 μM, Sigma-Aldrich, Merck, #40227), Hoechst 33342 (80 uM ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell nuclei were stained with DAPI (4 ’,6-diamidino-2-fenilindol) and slides were mounted using FluorSave™ Reagent (Merck Millipore). The sections were observed and visualized on a Leica DM2500 fluorescent microscope (Leica Microsystems) ...
-
bioRxiv - Systems Biology 2022Quote: ... 70 kDa FITC-dextran and MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were purchased from Merck Life Science UK Ltd. ...