Labshake search
Citations for Merck :
201 - 250 of 5376 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... SV40 T Antigen (Ab-2) (Merck Millipore; DP02; 5 μg/ml). Secondary antibodies (all from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... Treatment with 2 µM hydrogen peroxide for 5 min (H2O2; Merck) was used to induce DNA strand-breaks and oxidative damage ...
-
bioRxiv - Genetics 2022Quote: ... 90 μl 5 M NaCl and 2 μl Pellet Paint (Merck) was added to each sample ...
-
bioRxiv - Neuroscience 2022Quote: ... with a Chromolith® RP-18 endcapped 5-3 guard cartridges (Merck, Darmstadt, Germany), operated under a flow rate of 0.3 mL/min ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by 3 PBS washes and blocking with 5% bovine serum albumin (BSA; Merck) for 1 hour ...
-
bioRxiv - Cancer Biology 2024Quote: ... The extracted 212Pb in 0.1 M HCl obtained from the emanation generator was adjusted to pH 5-6 with 5 M sodium acetate (Merck, Darmstadt, Germany) and mixed with TCMC-mAbs with specific activities of 1-50 MBq/mg ...
-
bioRxiv - Cancer Biology 2022Quote: ... special AT-rich sequence binding protein 2 (SATB2; clone EP281, Merck, USA; 1:200), and programmed cell death ligand 1 (PD-L1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μg purified recombinant LARK protein or 1 μg BG4 (MABE917, Merck, Darmstadt, Germany) was added ...
-
bioRxiv - Neuroscience 2023Quote: ... and NG2 (neuron-glial antigen 2, AB5320, Merck Millipore, Burlington, MA, USA, 1:400) were used.
-
bioRxiv - Physiology 2024Quote: ... in trypsin (1 mg/ml, Merck, UK, rocked at 4°C for 2 hours) followed by collagenase (type IV ...
-
bioRxiv - Developmental Biology 2024Quote: ... 50 μg ml−1 L-Ascorbic acid 2-phosphate sesquimagnesium salt hydrate (Merck A8960), 20 ng ml−1 heregulin beta-1 (Thermo Fisher 100-03-50UG) ...
-
bioRxiv - Plant Biology 2020Quote: Inflorescences were harvested into fresh fixative (3:1 96% [v/v] ethanol [Merck] and glacial acetic acid) and kept overnight (O/N ...
-
bioRxiv - Biochemistry 2022Quote: ... and concentrated to 13.7 mg·ml-1 (A280=23.36) using a centrifugal filter (Amicon Ultra-0.5, MWCO 3 kDa, Merck Millipore) prior to crystallization ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 % (w/v) Bovine serum albumin and 3 % (v/v) goat serum (Merck Life Science cat. G9023). Following blocking ...
-
bioRxiv - Immunology 2022Quote: ... The coverslips were treated with 1% v/v solution of (3-acryloxypropyl)trimethoxysilane (APS, Merck - Sigma Aldrich) in ethanol for 1 h ...
-
bioRxiv - Microbiology 2022Quote: ... cells were fixed and permeabilized with a 3:1 mixture of methanol (Klinipath)-glacial acetic acid (Merck) for 10 min ...
-
bioRxiv - Genomics 2024Quote: ... Traps deployed by BCC were also baited with 1-octen-3-ol (Merck Life Science, Bayswater, Australia) (van Essen et al. ...
-
bioRxiv - Bioengineering 2022Quote: ... The coverslips were treated with 1% v/v solution of (3-acryloxypropyl)trimethoxysilane (APTS, Merck - Sigma Aldrich) in ethanol for 1 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... incubated with rabbit-α-pH3Ser10 (1:250 for 3 hours at room temperature; Merck Millipore, Burlington, MA), incubated with goat-α-rabbit-AF568 (1:250 for 45 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... diluted 1:1000) and vinculin loading control (Cell signalling #4650, diluted 1:1000) in 5% bovine serum albumin (BSA) (Merck, Kenilworth, NJ, United States)/TBS-Tween overnight at 4° C ...
-
bioRxiv - Microbiology 2023Quote: ... 1 filter disc (6 mm) impregnated with 5 µM of 30% (v/v) H2O2 (Merck) was placed on the seeded plate ...
-
bioRxiv - Neuroscience 2023Quote: Place 100 μl trypsin and 100 μl collagenase (per 2 animals) in a 35 mm dish: 2 mg ml-1 Trypsin (Merck - 85450C) and 682 U ml−1 Collagenase in Ca2+ and Mg2+ free medium
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were blocked in 5% BSA TBS-T or 5% skim milk TBS-T and incubated overnight at 4°C with the following primary antibodies diluted in 5 % BSA or 5% skim milk dissolved in TBS-T: pSer293-PDH (1:1,000) (Merck Millipore, Cat. no. ABS204), PDH (1:1,000 ...
-
bioRxiv - Microbiology 2024Quote: ... and 300 nM 4′,6′-diamidino-2-phenylindole (DAPI) (Merck, Germany; #28718-90-3). Fluorescence signals were observed by an ECLIPSE TE2000-U fluorescence microscope (Nikon ...
-
bioRxiv - Microbiology 2024Quote: ... 2–3 mL of stock solution was applied to preparative TLC plates (glass, Merck, 20x20 cm ...
-
bioRxiv - Neuroscience 2024Quote: ... xylene (2 x 5 min) and coverslipped using Entallan mounting medium (Merck). Samples were imaged using an Olympus BX51 microscope equipped with an Olympus DP27 digital camera (Olympus Microscope Solutions).
-
bioRxiv - Neuroscience 2023Quote: ... and stained with 5 µM 4′,6-diamidino-2-phenylindole (DAPI) (Merck) in PBS if required ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 nM T3 supplement (3,3′,5-triiodo-l-thyronine sodium salt) (Merck), and 100 IU/mL penicillin and 100 µg/mL streptomycin (Merck ...
-
bioRxiv - Neuroscience 2021Quote: ... we embedded the brains in 3-5 % oxidized agarose (Type-I agarose, Merck KGaA, Germany) and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4 ...
-
bioRxiv - Neuroscience 2022Quote: ... we embedded the brains in 3-5 % oxidized agarose (Type-I agarose, Merck KGaA, Germany) and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4 ...
-
bioRxiv - Microbiology 2024Quote: ... polyethylene glycol was added to a final concentration of 5% (Cat # 25322-68-3, Merck), and a LFA strip (Cat # 3822-9000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... DLD-1 cells expressing different EPHB1 wildtype or mutant versions and EFNB1 were mixed in suspension at a ratio of 1:3 and plated at a density of 130,000 cells/cm2 on coverslips coated with 2 mg/cm2 of 1-2 mg/mL laminin (Merck KGaA, Germany, USA) and incubated at 37ºC in 5% CO2 ...
-
bioRxiv - Biochemistry 2020Quote: TSEN complexes were mixed to a final concentration of 1 or 3 μM with 4x SYPRO Orange (Merck) stock in 50 mM HEPES-NaOH ...
-
bioRxiv - Cell Biology 2022Quote: ... Fibers were washed 3×10 min in PBS and incubated in blocking buffer (1% bovine serum albumin (Merck), 5% goat serum (16210-064 ...
-
bioRxiv - Molecular Biology 2024Quote: ... air-dried at RT for 30 min and fixed in Methanol:Acetic acid in a 3:1 ratio (Merck) at 4°C overnight ...
-
bioRxiv - Cancer Biology 2022Quote: ... cell-free samples were fixed for 1 hour at room temperature with 2% glutaraldehyde (Merck) in 0.1M cacodylate buffer ...
-
bioRxiv - Developmental Biology 2023Quote: ... rat anti tyrosinated-α-tubulin 1:250 (MAB1864-I, clone YL1/2, EMD Millipore/Merck), mouse anti-Armadillo/β-Catenin 1:50 (N27A1 ...
-
bioRxiv - Neuroscience 2024Quote: ... 2% OsO4 (buffered in ddH2O) at RT for 90 min and 1% uranyl acetate (Merck) aqueous solution at 4℃ for 12 hours.
-
bioRxiv - Neuroscience 2024Quote: ... After saponification with 2 mL of 1 M 95% ethanolic sodium hydroxide solution (Merck, Germany) (60°C ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 10% 2-mercaptoethanol at a 4:1 ratio (Merck, Sigma-Aldrich, cat. M6250) and heated at 55 °C for 7 min ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 50 μL magnetic beads were incubated with 5 μg of Ago-1 antibody (Merck, Millipore, Germany) or IgG antibody (Merck ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... For removal of chorion embryos were incubated for 5 mins with 1 mg/ml Pronase (Merck) then washed with culture medium and flash-frozen in liquid nitrogen ...
-
bioRxiv - Bioengineering 2024Quote: ... and 5 mg ml-1 fibrinogen from bovine plasma type I-S (Merck KGaA, Darmstadt, Germany); then ...
-
bioRxiv - Microbiology 2022Quote: ... α: β: γ: δ = 1:1:1:1 was obtained from Merck (Darmstadt, Germany).
-
bioRxiv - Biochemistry 2022Quote: ... 2 M NaCl using a 3 kDa MWCO Amicon Ultra Centrifugal Filter Unit (Merck Millipore) and mixed with tailless Xl histone octamer in the same buffer at a molar ratio 2:1 APLFAD-Δ:histone octamer on ice ...
-
bioRxiv - Developmental Biology 2023Quote: ... and blocked for 2 hours in PBS-T with 3% bovine serum albumin (BSA, Merck) and 5% normal sheep serum (Merck) ...
-
bioRxiv - Neuroscience 2021Quote: ... This was followed by a 3 h blocking step with 5 % NGS (G9023, Merck, Darmstadt Germany) in the respective washing buffer ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...