Labshake search
Citations for Merck :
401 - 450 of 5376 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... The tissue sections from the in vivo experiment were incubated with a rabbit primary antibody for GluR2/3 (Merck Millipore; AB1506; 1:200) overnight and then with a secondary goat anti-rabbit IgG (Cell Signaling Technology ...
-
bioRxiv - Plant Biology 2023Quote: ... The sections were then incubated for 1 h with 700 µL of a 10% (v/v) DMSO/3% (v/v) IGEPAL® CA-630 (Merck, Darmstadt, Germany) in MTSB ...
-
bioRxiv - Cancer Biology 2024Quote: ... The following day the membrane was washed with T-PBS (0.1% tween) (15 min x 3 times) and appropriate secondary antibody: (i) anti-rabbit antibody conjugated with peroxidase enzyme (Merck Sigma, Burlington, MA) was dissolved in 5% BSA in T-PBS (0.1% tween ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM GSK-3 Inhibitor XVI (Merck, 361559) and 0.8 μM PD184352 (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-total-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (anti-tAMPAR) (Cat.#AB1504, Merck Millipore, Burlington, MA, USA), anti-phospho (Ser845)-AMPAR (anti-pAMPAR;cat.#AB5849 ...
-
bioRxiv - Microbiology 2024Quote: ... hsa-miR-21-5p scramble microRNA mimic and a double-stranded small RNA oligonucleotide control (sequence: 5’- GGAACGCCAACCGAAGUCUA - 3’) (all from Merck) were added to achieve a final concentration of 250 nM on each well ...
-
bioRxiv - Biochemistry 2024Quote: Lipids (1 mg from the brain and 3–5 mg from the testis) were separated via TLC (Silica Gel 60 TLC plate, Merck) with methyl acetate/2-propanol/chloroform/methanol/0.25% calcium chloride in water (25:25:25:10:9 ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by signal development for 6–24 h in a solution containing nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Merck). The samples were covered with glass coverslips using CC/Mount (Merck) ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 μL of each sample was injected into a Chromolith FastGradient RP 18-e column (50 x 3 x 2 mm; monolithic silica with bimodal pore structure, macropores with 1.6mm diameter; Merck) protected by a precolumn (Gemini NX RP18 ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of the bacteriocin sample was loaded onto the trap column at 3% (v/v) ACN (Merck, USA) containing 0.1% (v/v ...
-
bioRxiv - Neuroscience 2022Quote: ... The PDMS microstructures were then rinsed with 2:3 HEPES1/ethanol and with ultrapure water (Milli-Q, Merck-MilliPore). PVP (1.3 MDa ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 × 106 CGNs were mixed with 2 μg of a Mission shRNA vector for Snph (TRCN0000201959, Merck, Darmstadt, Germany) or pLKO.1-TRC-control (Addgene_#10879 ...
-
bioRxiv - Immunology 2021Quote: ... blocked in 5% BSA for 30 min and incubated ON with mouse anti-GAD67 monoclonal antibody (1:6000, MAB5406, Merck Millipore) or 1 h with rabbit polyclonal anti-GAPDH antibody (1:3000 ...
-
bioRxiv - Genomics 2023Quote: ... 20 µL of frozen cells were lysed by a 3-min incubation at 100°C in 5% boiling SDS with 2x final concentration of Protease Inhibitor Cocktail Set 1 (Merck Chemicals). After centrifugation (5 min 15000g) ...
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies (FUS 1:100 Santa Cruz Biotech sc-47711; ISL1 1:500 Abcam ab109517; OLIG2 1:100 R&D Systems AF2418; NFM 1:1000 Merck MAB1621) were added in 1% BSA and incubated at 4degC overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... the sections were incubated overnight with a primary antibody mixture of guinea pig anti-glycine transporter 2 (GlyT2; 1:10,000; AB1773, Merck, RRID:AB_90953) and mouse anti-GAD67 (1 µg/ml ...
-
bioRxiv - Genetics 2020Quote: ... Bone tissue was cut into 2-mm pieces and placed in PBS buffer containing 4% paraformaldehyde (Schuchardt, Muenchen, Germany) and 1% glutaraldehyde (Merck, electron microscopy grade ...
-
bioRxiv - Bioengineering 2021Quote: ... The cells were transduced with LV particles at low multiplicity of infection (MOI: 1-2) in the presence of 10 µg/mL of polybrene (Merck). HEK293T-EGFP were selected with 1 µg/mL of puromycin ...
-
bioRxiv - Genomics 2021Quote: Cultures of three Lasiodiplodia and five Neofusicoccum species (Table 1) were inoculated onto cellophane covered 2 % malt extract agar (MEA; Biolab, Merck) and incubated at 22 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The blocks were then washed with DDW 2 times for 10 min and incubated in 1% (w/v) uranyl acetate (Merck)/70% (v/v ...
-
bioRxiv - Microbiology 2022Quote: ... the Milliplex SARS-CoV-2 Antigen Panel 1 IgG was used according to the manufacturer’s instructions (Merck Millipore, Darmstadt, Germany).
-
bioRxiv - Cancer Biology 2020Quote: ... cells were lysed in 500 μl of lysis buffer (8 mL of cold PBS and 2 mL of 10% Triton X-114 supplemented with Halt Protease inhibitor (1:100) and Bezonase (Merck) (1:1000)) ...
-
bioRxiv - Microbiology 2021Quote: ... Acid digestion was then performed for 3 h at 90°C placing the PP tubes on Teflon heating blocks after adding 2 mL hydrochloric acid and 1 mL nitric acid (10 M HCl and 14 M HNO3, respectively, both Suprapur, Merck) following protocol adapted from (62 ...
-
bioRxiv - Cancer Biology 2021Quote: Primary HPMECs in EBM2 medium or ST1.6R cells in DMEM/1% FBS were cultured overnight and stimulated with 2 μg/ml of recombinant TNC (Merck Millipore) for 24 h ...
-
bioRxiv - Biochemistry 2021Quote: ... Lipids containing [6-3H]GlcN-PI were dissolved in 100 μL of chloroform: methanol (2:1, by volume) and loaded to a high performance thin-layer chromatography (HPTLC) plate (Merck). The [6-3H]GlcN-PI was located by phosphorimaging ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 1-oleoyl-2-acetyl-sn-glycerol (OAG) and 4α-phorbol 12,13-didecanoate (4α-PDD) were obtained from Merck (Gillingham, UK). Sphingosine-1-phosphate (S1P ...
-
bioRxiv - Neuroscience 2021Quote: ... MDMi cells were incubated with a primary antibody against Iba1 (1:1,000; 019-19744, FUJIFILM Wako Chemicals) in blocking buffer (2% bovine serum albumin, 0.1% TritonX100 (Merck, Darmstadt, Germany), and 5% normal donkey serum (017-000-121 ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was eluted from the filter with 2 x 50 µl of Elution Buffer and 1 x 50 µl with DEPC-treated Molecular Biology Grade water (Merck). RNA samples were quantified with NanoDrop 2000 Spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... FOs were sonicated 2 x 10 sec in ice-cold 1:2 methanol/chloroform solvent containing SPLASH LIPIDOMIX MS standard internal standard mix (Merck). 1:6 H2O was added to the samples before shaking at 1000 rpm ...
-
bioRxiv - Microbiology 2024Quote: ... from the resin was immediately neutralized with 1/10 faction volume of 1 M Tris-HCl pH 8.5 and concentrated using an Amicon Ultra-2 Centrifugal Filter Unit 100kDa NWMCO (Merck Millipore), in which the elution buffer was exchanged with PBS (GIBCO).
-
bioRxiv - Biochemistry 2023Quote: ... Peak fractions were concentrated to 2 mg mL-1 using 100 kDa molecular weight cut-off centrifugal filters (Merck Millipore). To each 300-mesh holey carbon grid (Au R1.2/1.3 ...
-
bioRxiv - Neuroscience 2024Quote: ... the brains were removed and post-fixed for 1–2 days before transfer to 30% sucrose (Merck KGaA, Darmstadt, Germany) dissolved in PBS ...
-
bioRxiv - Bioengineering 2024Quote: Fresh macroscopically normal omental and peritoneal tissues were cut into 1-2 mm3 pieces and placed into non-adherent U-bottom 96 well plates (Merck). A solution with 10,000 cells in 10 μl media was added and cells were allowed to attach to the tissues for 2 h at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tubulin beta (1:8,000; clone KMX-1 from Merck Millipore), dMi-2 (1:8,000 ...
-
bioRxiv - Neuroscience 2021Quote: ... and anti-TUJ-1 antibodies (1:200; Merck-Millipore, MAB380) for 48 h ...
-
bioRxiv - Microbiology 2021Quote: ... GLP-1 (GLP-1 total ELISA kit, Merck, Darmstadt, Germany) and biochemical parameters including ALT ...
-
bioRxiv - Cell Biology 2021Quote: ... Armenian hamster PECAM-1 (MAB1398Z, Merck Millipore, IHC: 1/500); goat VE-cadherin (sc-6458 ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 μL RNase A (10 U µL−1) (Merck) per mL of stock and incubated at 37°C for 30 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 mg ml−1 collagenase IV (Merck Millipore, C4-22) and 70 U ml−1 DNase (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... 1% (vol/vol) Protease Inhibitor Cocktail Set 1 (Merck Millipore) and 1x PhosSTOP (Roche) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1% (vol/vol) Protease Inhibitor Cocktail Set 1 (Merck Millipore) and 1x PhosSTOP (Roche) ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 mL of 40 mg mL− 1 EDC (Merck 341006) and 1 mL of 65 mg mL−1 sulfo-NHS (Merck 56485 ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells at a density of 5×105 /ml were supplemented with 2% dimethyl sulfoxide (DMSO; Merck) and the culturing was continued for another 24 to 72 hr ...
-
bioRxiv - Bioengineering 2022Quote: ... Five μL of the sample were injected into a C18 column (Merck Spherisorb ODS-2 (5 μm), 250×4 mm ...