Labshake search
Citations for Merck :
201 - 250 of 3401 citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... each coverslip was washed with PBS 3 times each for 5 minutes and nuclei were stained with Hoechst (Merck Sigma ...
-
bioRxiv - Systems Biology 2022Quote: ... 70 kDa FITC-dextran and MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were purchased from Merck Life Science UK Ltd. ...
-
bioRxiv - Microbiology 2020Quote: Cytotoxicity of the compounds were tested by use of a MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay (Merck) at a final MTT concentration of 0.45 mg/ml or by use of a ATPlite Luminescence Assay System (PerkinElmer ...
-
bioRxiv - Molecular Biology 2023Quote: Cells of 2-3 days growth with approximately 70-90% confluency have been treated with Bortezomib (Merck, #504314) at 100 nM for 42 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviral transductions were performed in a 6-well plate format (3 × 105 cells/well) using 10 µg/mL polybrene (Merck Millipore). Stably transduced cells were flow-sorted.
-
bioRxiv - Plant Biology 2023Quote: ... the dried pellets were redissolved in 80 % methanol (1µL/mg) and 3 µL were analysed by HPTLC on a Silica Gel 60 plate (Merck, Darmstadt, Germany). The mobile phase used was ethyl acetate ...
-
bioRxiv - Cell Biology 2023Quote: ... TUNEL staining was made according to the manufacturer’s instructions of the apoptosis detection kit in situ red (S7165, Merck-Millipore).
-
bioRxiv - Microbiology 2023Quote: ... Regular testing for mycoplasma contamination was performed to confirm contamination free culture using a PCR-detection kit (Sigma-Aldrich/Merck). The details of cell lines are provided in key resources table ...
-
bioRxiv - Immunology 2024Quote: ... LDH activity was quantified in the cell lysate of untreated cells and in all cell supernatants using the Cytotoxicity Detection Kit (LDH) from Merck, following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... cleared by xylene (2 x 5 min) and finally mounted in Entellan mounting medium (Merck, Germany). HE stained sections were observed and recorded using an ECLIPSE Ni microscope (Nikon ...
-
bioRxiv - Cancer Biology 2020Quote: ... media was replaced with media containing 10 nM 5-Bromo-2′-deoxyuridine (BrdU) (Merck, B5002-100MG). Coverslips were then fixed ...
-
bioRxiv - Immunology 2021Quote: ... The plates were then washed 5 times with HSWB followed by incubation of goat anti-mouse antibody (Merck, Germany) conjugated with HRP (diluted 1:3000 in LSWB + 1% BSA ...
-
bioRxiv - Microbiology 2019Quote: ... and 5 µl aliquots of the supernatants were applied to polyethyleneimine (PEI) cellulose thin layer chromatography plates (Merck, Sigma), resolved with 1.5 M KH2PO4 (pH 3.4 ...
-
bioRxiv - Microbiology 2023Quote: ... Single colonies from those plates were inoculated in 5 mL of tryptic soy broth (TSB; Merck KGaA, Darmstadt, Germany) and incubated for 16 - 18 h at 37°C with shaking at 200 rpm ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were seeded (2×104 cells/well) in 24-well plates in alphaMEM medium (Merck, Darmstadt, Germany, #F0925) plus 10 % FCS (Gibco ...
-
bioRxiv - Biophysics 2023Quote: ... 5 and 10 μl of the lipid extract 2 cm from the bottom on aluminum-backed silica gel 60 TLC plates (cat#: 1.05553.0001; Merck) together with DOPG ...
-
bioRxiv - Biochemistry 2023Quote: ... Reactions were stopped with 2 µl of 0.5 M EDTA and separated using thin layer chromatography plates (Merck) with 0.3 M LiCl and 0.3 M formic acid as the mobile phase ...
-
bioRxiv - Biochemistry 2023Quote: The reaction mixtures (0.5, 1 or 2 µL) were spotted onto TLC Silica Gel 60 F254 plates (Merck). As for analysis of cyclization activity ...
-
bioRxiv - Microbiology 2023Quote: Fixed murine feet were decalcified using the EDTA-based Osteosoft solution (Merck) and then embedded in paraffin for histological analysis.by Ziehl-Neelsen stain ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM GSK-3 Inhibitor XVI (Merck, 361559) and 0.8 μM PD184352 (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-total-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (anti-tAMPAR) (Cat.#AB1504, Merck Millipore, Burlington, MA, USA), anti-phospho (Ser845)-AMPAR (anti-pAMPAR;cat.#AB5849 ...
-
bioRxiv - Neuroscience 2020Quote: The cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 μL of each sample was injected into a Chromolith FastGradient RP 18-e column (50 x 3 x 2 mm; monolithic silica with bimodal pore structure, macropores with 1.6mm diameter; Merck) protected by a precolumn (Gemini NX RP18 ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of the bacteriocin sample was loaded onto the trap column at 3% (v/v) ACN (Merck, USA) containing 0.1% (v/v ...
-
bioRxiv - Neuroscience 2022Quote: ... The PDMS microstructures were then rinsed with 2:3 HEPES1/ethanol and with ultrapure water (Milli-Q, Merck-MilliPore). PVP (1.3 MDa ...
-
bioRxiv - Neuroscience 2024Quote: ... for 180 min prior to washing and development in Streptavidin-tertiary reagent (1:500 in 2% BSA and 0.1% Triton [TBS]) conjugated to either Cyanine 3 (Cy3) (Merck) or Alexa Fluor 488 (Life technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 × 106 CGNs were mixed with 2 μg of a Mission shRNA vector for Snph (TRCN0000201959, Merck, Darmstadt, Germany) or pLKO.1-TRC-control (Addgene_#10879 ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 × 105 cells were seeded on the upper chamber of 24 well plate cell culture inserts containing 3 μm pores (Merck, Cat # 353096) coated with rat-tail collagen I (Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Duolink Detection Reagents Red or Green (Merck) were used to perform the PLA reaction ...
-
bioRxiv - Neuroscience 2020Quote: Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) histochemistry was performed using the ApopTag Peroxidase In Situ Apoptosis Detection Kit (Merck Millipore), according to the instructions of the manufacturer ...
-
bioRxiv - Cancer Biology 2023Quote: Protein lysate was prepared in 1X CHAPS Lysis Buffer and the assay was performed using TRAPeze™ RT Telomerase Detection Kit (Merck) per manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: ... the cells at a density of 5×105 /ml were supplemented with 2% dimethyl sulfoxide (DMSO; Merck) and the culturing was continued for another 24 to 72 hr ...
-
bioRxiv - Bioengineering 2022Quote: ... Five μL of the sample were injected into a C18 column (Merck Spherisorb ODS-2 (5 μm), 250×4 mm ...
-
bioRxiv - Plant Biology 2023Quote: ... pericarp sections were incubated for 2 h in a 5% (v/v) Normal Donkey serum (NDS; Merck) blocking solution in MTSB ...
-
bioRxiv - Developmental Biology 2024Quote: ... cells were labeled with 20 mM 5-chloro-2-deoxyuridine (CldU, Sigma-Aldrich by Merck, Darmstadt, Germany) for 20 min ...
-
bioRxiv - Microbiology 2021Quote: ... PBMCs (2 × 106 cells) were plated onto 48-well plates (NalgeNunc) in RPMI-1640 with 5% inactivated male human AB serum (Merck) for 3 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the plates were incubated at 33 °C in a 5% CO2 atmosphere in fresh medium with 0.25% Hoechst (Merck-Millipore) to stain the DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... samples were centrifuged at 14,000 rpm at room temperature for 5 minutes or filtered in multiscreenHTS-HV 0.45 µm 96 well filter plates with PVDF membranes (Merck Millipore) to remove cell debris and nucleic acid aggregates ...
-
bioRxiv - Microbiology 2020Quote: The TLC was performed by spotting 2 μL of enzymatic reaction on a silica gel 60 F454 plate (Merck), the separation was carried out in butanol ...
-
bioRxiv - Plant Biology 2023Quote: ... dried and transferred in a grid pattern onto square plates containing 50 ml of MS/2 medium (0.5× Murashige and Skoog salts [Merck Sigma-Aldrich] ...
-
bioRxiv - Molecular Biology 2022Quote: ... The Lipid II extract was assessed by spotting 1-2 μL on a HPTLC silica gel 60F254 plate (Merck). The TLC plate was developed in a mixture of chloroform:methanol:water:ammonia (88:48:10:1 ...
-
bioRxiv - Microbiology 2022Quote: ... Cytokine and chemokine levels were measured with a commercial rat cytokine/chemokine magnetic bead panel 96-well plate assay kit (Milliplex MAP kit, Merck Millipore), which detects 5 cytokines and chemokines including IP-10/CXCL10 ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...
-
bioRxiv - Cell Biology 2023Quote: ... P1 virus was used to infect 50 ml of SF9 culture and P2 virus was harvested after 3-5 days through centrifugation and subsequent filtration through 0.45 μm PVDF membrane (Merck Millipore, SLHV033RS). P2 virus was either propagated further or stored at 4ºC in the dark ...