Labshake search
Citations for Merck :
1 - 50 of 3139 citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... the mice were intranasally sensitized using 1 μg of 2′3′-cyclic GMP-AMP (cGAMP, 531889; Merck Darmstadt, Germany) and 1 μg of (HDM ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Microbiology 2023Quote: ... 2–3 mL of stock solution was applied onto preparative TLC plates (glass, Merck, 20×20 cm ...
-
bioRxiv - Physiology 2021Quote: ... filtered through a 0.22 μm PVDF-based filter plate (Merck Millipore), and analyzed by LC-MS/MS ...
-
bioRxiv - Cell Biology 2023Quote: ... plates were treated with 3-amino-propyltrimethoxysilane (diluted 1:2 with PBS; Sigma-Aldrich/Merck) for 15min at RT ...
-
bioRxiv - Biochemistry 2019Quote: The detection of apoptotic cells was based on the nick-end (TUNEL) labelling method using the ApopTag® in situ detection kit (S7100, Merck Millipore, USA), according to the manufacturing protocol.
-
bioRxiv - Immunology 2020Quote: ... 2-3 × 105 cells/well were plated in an ELI Spot plate (MAHAS4510, Merck Millipore, USA) and in vitro cultured for 18-24 hours in media supplemented with or without peptide at 0.5 µM (or ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 20 μl, 5 mg/ml, Merck) was added to each well ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Microbiology 2023Quote: ... TNF-alpha and IL-10 in serum were determined using bead-based Multi-Plex kits (MILLIPLEX® Mouse Cytokine/Chemokine Magnetic Bead Panel 96-Well Plate Assay, Merck KGaA ...
-
bioRxiv - Cell Biology 2021Quote: ... the alkaline phosphatase detection kit (Merck) was used following manufacturer’s instructions.
-
bioRxiv - Systems Biology 2022Quote: ... 2 x 3’ Neoclear (Merck), 2 x 3 ‘ 100% ETOH ...
-
bioRxiv - Immunology 2023Quote: ... All cell lines were routinely tested for mycoplasma contamination using LookOut Mycoplasma qPCR Detection Kit (Merck 200-664-3). None of the cell lines were authenticated but low passage numbers were utilized.
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Cell Biology 2023Quote: ... post-fixed in cooled ethanol:acetic acid (2:1) and stained using a TUNEL kit (ApopTag® Fluorescein In Situ Apoptosis Detection Kit, Merck Millipore, #S7110) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... the medium was replaced with complete medium without phenol red and 10 μL of 5 mg/mL MTT solution (In vitro toxicology assay kit, MTT-based, TOX-1KT, Merck, Darmstadt, Germany) were added to each well ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). For Ki67 and IBA1 staining ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... exposure was evaluated by a MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) test in a 96-well plate according to the manufacturer’s (Merck) protocol ...
-
bioRxiv - Genetics 2021Quote: ... At day 10 cells were passaged at a 2:3 ratio into 12 well cell culture plates coated with 15 µg/ml human plasma fibronectin (Merck) in Dulbecco’s phosphate-buffered saline (DPBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... An enhanced chemiluminescence (ECL) detection kit (Merck Millipore) was used to develop the membranes ...
-
bioRxiv - Microbiology 2021Quote: ... Isolated lipids were dissolved in 30 μL of chloroform:methanol (2:1, v/v) and 5 μL loaded on thin-layer chromatography (TLC) silica gel plates F254 (Merck). Lipids were separated in chloroform/methanol/water (20:4:0.5 ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Cell Biology 2024Quote: ... HRP-mediated substrate development was performed using Amersham detection system (ECL Western Blot detection kit, Merck). Blots were imaged using ChemiDoc™ MP Imaging System (Bio-Rad).
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: MDCK cells (2 x 105 cells) were cultured on polycarbonate Millicell culture plate inserts (12- mm diameter, 3-µm pore size; Merck Millipore) at 37°C under 5% CO2 atmosphere.
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Microbiology 2023Quote: ... resuspended in 50 µL chloroform : methanol (2 : 1) and 5 µL were loaded on silica gel 60 F254 plates (Merck). To separate trehalose esters of mycolates (TDM ...
-
bioRxiv - Bioengineering 2020Quote: ... or ApopTag® ISOL fluorescence apoptosis detection kit (Merck Millipore ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Biochemistry 2022Quote: The matrix 2′,5′-dihydroxyacetophenone (DHAP; Merck) was applied by sublimation and the data were acquired on a modified timsTOF fleX instrument (Bruker Daltonics ...
-
bioRxiv - Cancer Biology 2021Quote: ... ApopTag plus peroxidase in situ apoptosis detection kit (Merck Millipore) was used according to the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2022Quote: ... the ApopTag Red In Situ Apoptosis Detection Kit (Merck, S7165) was used ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Anti-Citrulline (Modified) Detection Kit (cat. 17-347B, Merck) was used to measure global citrullination 88 ...
-
bioRxiv - Molecular Biology 2024Quote: ... fixed with 2% paraformaldehyde (PFA) in PHEM and washed once for 5 min at (RT) with 3% BSA (bovine serum albumin, Merck-Sigma, Germany) in Tris-buffered saline with 10 mM EGTA and 2 mM MgCl2 (TBSTEM) ...
-
bioRxiv - Microbiology 2019Quote: ... TLC plates (3 × 10 cm) (TLC Silica Gel 60 F254, Merck) were spotted by simply touching the end of a capillary tube containing fungal crude extract to the coated side of the TLC plates ...
-
bioRxiv - Microbiology 2020Quote: ... XTT based (TOX2; Merck)(Roehm et al ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 × 3 min Neo-Clear (Cat. No. 1.09843, Merck), 2 × 3 min 100% ethanol ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Neuroscience 2022Quote: ... was combined with 90μM sygRNA (5’ - GGATTTGGTAATAGCAG AGGGGG 3’) (Merck) at RT for 15 minutes to form an RNP complex ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA oligonucleotide G4A4 (5’-AAAAAAGGGGAAAAGGGGAAAAGGGGAAAAGGGGAAAAAA-3’) was purchased from Merck. CD analysis of 2,5 µM RNA was carried out in the buffer used for G4-pulldown ...
-
bioRxiv - Cell Biology 2022Quote: ... Immunoreactive bands were detected using ECL detection reagent kit (Merck-Millipore) and the FusionSL chemiluminescence documentation system (Vilber-Lourmat) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and stained using the AldeRed ALDH detection assay kit (Merck SRC150) according to manufacturer specifications.
-
bioRxiv - Cell Biology 2023Quote: ... and bands were detected using chemiluminescence detection kit (Merck Millipore; WBKLS0050).
-
bioRxiv - Cell Biology 2022Quote: ... the ApopTag® Red In Situ Apoptosis Detection Kit (Merck S7165) was used ...