Labshake search
Citations for Merck :
2001 - 2050 of 2960 citations for 6 4 OXO 2 THIOXO THIAZOLIDIN 3 YL HEXANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... fractions containing monomeric scFV were concentrated with Amicon Ultra-4 centrifugal filters (10 kDa cut off, Merck). 14.4.4 scFV without an unpaired cysteine were randomly conjugated on surface-exposed lysine residues with Alexa Fluor 555 carboxylic acid ...
-
bioRxiv - Immunology 2023Quote: ... Cytiva) and monomeric fractions were concentrated with Amicon Ultra-4 centrifugal filters (10 kDa cut off, Merck).
-
bioRxiv - Microbiology 2023Quote: ... the sample was concentrated to 500 μl using a 100 kDa concentrator (Amicon Ultra 4 - Merck Millipore) injected on an ÄKTA pure FPLC using a Superose 6 increase column 10/300 GL (Cytiva ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The blotted membrane was incubated overnight at 4 °C with a polyclonal anti-ADAR antibody HPA051519 (Merck) diluted 1:500 with 0.1% TBST containing 5% BSA at final concentration ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were sub-cultured on days 4 and 8 of differentiation onto human fibronectin (Merck Millipore, #FC010) coated plates at a ratio of 1:4 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated overnight at 4 °C with primary antibodies against puromycin (mouse monoclonal 1:500, Merck), Par3 (rabbit polyclonal 1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated overnight at 4 °C with an anti-puromycin antibody (mouse monoclonal 1:500, Merck) combined with an anti-β-actin antibody (rabbit polyclonal 1:1000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the slides were incubated with 4 µg/mL of anti-digoxigenin Fab fragments conjugated with FITC (Merck) and 1/2,000-diluted streptavidin conjugated with alexa405 (Vector Laboratories ...
-
bioRxiv - Biophysics 2023Quote: ... the LUVs were transferred to an Amicon Ultra-4 100 kDa centrifugal filter unit (Merck, Darmstadt, Germany) and concentrated by centrifuging at 2000g ...
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies were applied overnight at 4°C and included TH (Pel-Freez Biologicals #P40101 and Merck Millipore #AB9702 ...
-
bioRxiv - Bioengineering 2023Quote: ... PLGA 50:50 (Lactel/Evonik B6010-4) and PLGA 85:15 (Expansorb® DLG 85-7E, Merck) were both ester terminated and had a weight average molecular weight of between 80-90 kDa ...
-
bioRxiv - Bioengineering 2023Quote: ... PLGA 50:50 (Lactel/Evonik B6010-4) and PLGA 85:15 (Expansorb® DLG 85-7E, Merck) were both ester terminated and had a weight average molecular weight of 80-90 kDa ...
-
bioRxiv - Molecular Biology 2022Quote: ... concentrated with an Amicon ultra-4 centrifugation filter with a 10 kDa molecular weight cutoff (Merck Millipore), snap frozen and stored in -80 °C either directly (used for cryo-EM ...
-
bioRxiv - Genomics 2024Quote: ... Digestion was followed by a Tris-EDTA wash using Amicon® Ultra 4 mL filter (Merck Millipore) followed by a DNA purification step using the “QIAQuick minElute purification kit” (Qiagen ...
-
bioRxiv - Bioengineering 2023Quote: ... PLGA 50:50 (Lactel/Evonik B6010-4) and PLGA 85:15 (Expansorb® DLG 85-7E, Merck) were both ester terminated and had a weight average molecular weight of between 80-90 kDa.
-
bioRxiv - Cancer Biology 2023Quote: ... 20 mL of virus supernatant is concentrated using Amicon Ultra-4 30K centrifugal filters (Merck, cat# UFC803024). For transduction of suspension cells ...
-
bioRxiv - Biochemistry 2023Quote: ... Hydroxyurea (HU) was used at 4 mM and nocodazole at 0.2 µg/ml (all acquired from Merck).
-
bioRxiv - Plant Biology 2024Quote: ... and proteins were concentrated using a 30 kDa Amicon Ultra-4 Centrifugal Filter Unit (Merck Milipore; www.merckmillipore.com). Protein concentration was determined employing the Bio-Rad Protein Assay Dye Reagent Concentrate (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... Fractions containing LmdC were concentrated in an Amicon Ultra-4 10K spin concentrator (MWCO 10,000; Merck, Germany). After the removal of precipitates by centrifugation at 30,000 ×g for 30 min ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and the supernatants were transferred to ultrafiltration tubes (Amicon® Ultra-4 Centrifugal Filter Unit 10K, Merck), diluted with 2 ml TE (pH 8.0 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and secondary antibody anti-rabbit (CST, 1:3000) diluted in PBS containing 4% skim-milk powder (Merck) and 0.2% Tween 20 (Sigma).
-
bioRxiv - Molecular Biology 2024Quote: ... diluted 1:1 (v:v) with water containing 4 mM MgCl2 and benzonase (Merck #70746, 250 U/µl), and incubated for 15 min at RT to digest nucleic acids ...
-
bioRxiv - Biophysics 2020Quote: ... 105 cells were seeded on the upper chamber of 24 well plate cell culture inserts containing 3 µm pores (Cat # 353096, Merck). The inserts were coated with rat-tail collagen I ...
-
bioRxiv - Cell Biology 2020Quote: ... Viruses were collected from the supernatant 24 hours later and cleared by centrifugation at 2000 rpm for 3 minutes followed by filtration with 0.45 µm PVDF syringe filter units (Merck, #SLHV033RS). Cleared supernatants were titrated by plaque assay using BHK-21 cells.
-
bioRxiv - Microbiology 2019Quote: A sample (10 mL) was removed from the Gambierdiscus culture and filtered through 3-μm membrane (Merck Millipore, Darmstadt, Germany). One hundred microliters of the filtrate ...
-
bioRxiv - Evolutionary Biology 2020Quote: Larvae were raised as described above until 11 dpf and deeply anesthetized with 160 mg/l of Tricaine (Ethyl 3-aminobenzoate methanesulfonate salt, MS-222, Merck) before dissecting their pectoral fins ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were permeabilized with 0.1 % Triton-X100 in PBS for 20 min at RT and samples were blocked with freshly prepared 3 % bovine serum albumin (BSA, Merck) in PBS for 1 h at RT ...
-
bioRxiv - Molecular Biology 2021Quote: Heat-mediated antigen retrieval was performed for 3 min at 99°C in a 40mM trisodium citrate (Merck, Darmstadt, Germany) solution ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Neuroscience 2019Quote: ... The HiTrap SP elution fractions containing the Tau proteins were concentrated using a 30 MWCO (for full length tau) or 3 MWCO (for tau fragments) Amicon centrifugal filter unit (Merck) and loaded on a HiLoad 16/600 Superdex 75 pg size exclusion chromatography column (GE Healthcare ...
-
bioRxiv - Immunology 2020Quote: ... After incubation cells were washed 3 times with PBS containing 0.5% BSA and subsequently fixed 1% (w/v) paraformaldehyde (PFA, Merck Millipore) in PBS ...
-
bioRxiv - Biochemistry 2020Quote: ... Chromatographic separation of AAs was achieved by applying 3 μl of dissolved sample on a SeQuant ZIC-HILIC column (3.5 μm particles, 100 × 2.1 mm) (Merck, Darmstadt, Germany), combined with a Javelin particle filter (Thermo Scientific ...
-
bioRxiv - Bioengineering 2021Quote: The rat INS-1 832/3 cell line (insulinoma cell line stably transfected with human insulin; hereinafter INS-1) was obtained from Merck. A HUVEC (human umbilical vein endothelial cell ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Cell Biology 2021Quote: Cells were sonicated at low power for 3 s and loaded onto a commercial microfluidics system (Y04C-02 plates, CellASIC ONIX2 system, Merck). While loading the cells ...
-
bioRxiv - Biochemistry 2020Quote: ... each N-Cdh sample was desalted against PBS using Amicon centrifugal filters with a 3 kDa molecular weight cutoff according to the manufacturer’s protocol (Merck-Millipore). Unprocessed xCGE-LIG N-glycocomics raw data are available upon request.
-
bioRxiv - Bioengineering 2021Quote: ... 99%+, Figure S1(d)), and dimethyloctadecyl[3-(trimethoxysilyl)propyl]ammonium chloride (DMOAP, 42% solution in methanol) were obtained from Merck–Sigma Aldrich ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 100 μL aliquots were removed and the reaction was stopped using a 3 KDa nominal molecular weight limit (NMWL) centrifuge filter (Merck Amicon Ultra 0.5mL Centrifugal Filters ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Major peaks were desalted by RP-HPLC using an Ascentis C18 column (3 μm, 4.6mm ID x 15 cm, Sigma-Merck, Germany) using peak-based collection (slope) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell medium was replaced with 3 mL medium containing 20 μL of the purified lentivirus and 3μl polybrene transfection reagent (Merck Millipore). Medium was supplemented with 10 µg/mL puromycin for selection of successfully transduced cells two to three days after transduction.
-
bioRxiv - Cell Biology 2022Quote: ... The remaining media was then concentrated down to 500 uL using a falcon tube sized 3 kDa amicon column (UFC900308; Merck) spun at 4000 xg and 4°C for approximately 1 h ...
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Bioengineering 2022Quote: ... 100 nM of RNA polyhedra samples folded in TE/Mg2+/Na+ buffer were concentrated four times using 3 kDa MWCO Amicon Ultra centrifugal filters (Merck). 5 µl of the concentrated sample was applied on 300 mesh Cu grids coated with lacey carbon (Agar Scientific) ...
-
bioRxiv - Biochemistry 2022Quote: ... Chromatography was performed on a zwitterionic (ZIC) column with phosphocholine phase (ZIC-cHILIC, 2.1 mm i.d. x 150 mm, 3 μm; Merck SeQuant, Sweden) [38] ...
-
bioRxiv - Biophysics 2020Quote: ... The Q column flow-through containing nsp8 or nsp7 was concentrated using a MWCO 3 kDa Amicon Ultra Centrifugal Filter (Merck) and applied to a HiLoad S200 16/600 pg equilibrated in size exclusion buffer (150 mM NaCl ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The five eluted aliquots were then concentrated using an ultrafiltration device with a 3 kDa cut-off membrane (Amicon Ultra-0.5 Centrifugal Filter Unit; Merck, UK) and desalted with filtered water to remove urea and salts ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... ssDNA was eluted and concentrated using an ultrafiltration device with a 3 kDa cut-off membrane (Amicon Ultra-0.5 Centrifugal Filter Unit; Merck, UK), as described earlier ...
-
bioRxiv - Biophysics 2022Quote: ... Annealed samples were exchanged to NMR buffer (20 mM potassium phosphate, pH 7.0) using 3 kDa centrifugal filters (Amicon, Merck Inc.) spun at 4000 g and 4 °C to a final volume of 250 µL ...
-
bioRxiv - Bioengineering 2019Quote: ... Tween 20 with 3 % (w/v) skim milk powder and successively incubated with monoclonal mouse anti-T7 RNA polymerase antibodies (Novagen, Merck) and POD labelled goat anti-mouse antibodies (Sigma) ...
-
bioRxiv - Neuroscience 2019Quote: ... The HiTrap SP elution fractions containing the tau proteins were concentrated using a 30 MWCO or 3 MWCO Amicon centrifugal filter unit (Merck) and loaded on a HiLoad 16/600 Superdex 75 pg size exclusion chromatography column (GE Healthcare ...