Labshake search
Citations for Merck :
151 - 200 of 1327 citations for IL 3 Mouse HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of Benzonase (Merck Millipore, US170664-3) was added and samples left on ice until an aqueous solution formed (30 min to 1 h) ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (BSA, Merck/Sigma-Aldrich) in PBS was added as blocking buffer and incubated for 1 hour ...
-
bioRxiv - Developmental Biology 2024Quote: ... passed through 3 drops of Advanced KSOM (Merck) and kept for 30 minutes in a drop of KSOM (Merck ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Biochemistry 2023Quote: ... The 100-fold dilution of culture was made up to 10-4 dilutions and spotted on TYE plates (Hi-Media Laboratories Ltd., India) having 1% glucose (Merck & Co., USA) and ampicillin (Gold Biotechnology ...
-
bioRxiv - Immunology 2023Quote: ... Lysate was clarified by spinning cells for 10 min at 20,000 × g before loading supernatant onto cOmplete™ His-Tag purification resin (Merck; cat # 5893682001). Bound proteins were washed with 20 mM tris (pH 8.0) ...
-
bioRxiv - Immunology 2021Quote: ... and all fractions containing IL-22 were concentrated using a 10 kDa centrifugal filter (Merck Millipore, USA).
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Microbiology 2023Quote: ... The remaining 32P-γ-ATP was removed by washing with 3 column volumes of Millipore water and centrifugation in 10 kDa (Qβ-RNA) or 3 kDa (8mer) Amicon filters (Merck Millipore) at 14,000 rpm at 4 °C for four times ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV titer was quantified using PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... or mouse IgG (NXA931, Merck) and 1mg/ml of heparin for at 4 ֯C for 16 hours with end-over-end rotation ...
-
bioRxiv - Neuroscience 2021Quote: ... or mouse serum (Merck, M5905) as a mock condition (W ...
-
bioRxiv - Systems Biology 2022Quote: ... mouse anti-GAPDH (CB1001, Merck), rabbit phospho-Rb Ser807/811 (8516 ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-NeuN (Merck, MAB377), mouse anti-parvalbumin (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal anti-Rac1 (Merck Millipore ...
-
bioRxiv - Cell Biology 2023Quote: ... BUBR1 (mouse mAb, Merck, MAB3612), CENP-A (mouse mAb ...
-
bioRxiv - Cell Biology 2023Quote: ... tubulin (mouse mAb; Merck, T6199), BUB1 (rabbit pAb ...
-
bioRxiv - Microbiology 2022Quote: ... mouse anti-puromycin (Merck, MABE343) (1:10.000) ...
-
bioRxiv - Bioengineering 2023Quote: ... mouse anti-vinculin (V9131, Merck); rabbit anti-pYAP S127 (D9W21 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse TAP952 (1:500, Merck). For testing the expression of TTLL5 ...
-
bioRxiv - Bioengineering 2023Quote: ... mouse anti-Vinculin (V9131, Merck), anti-Col1A1 (91144S ...
-
bioRxiv - Bioengineering 2023Quote: ... mouse anti-Vinculin (V9131, Merck); anti-Col1A1 (91144S ...
-
bioRxiv - Immunology 2023Quote: ... and goat anti-mouse (Merck).
-
bioRxiv - Neuroscience 2024Quote: ... or mouse anti-GAPDH (Merck) was diluted 1:1000 in blocking buffer ...
-
bioRxiv - Genomics 2024Quote: ... Mouse anti-NeuN antibody (Merck Millipore ...
-
bioRxiv - Cell Biology 2023Quote: ... spermidine or MB-3 treatment, C646 (Med Chem Express, #HY-13823, USA), spermidine (Med Chem Express, #HY-B1776, USA) or MB-3 (Merck, #M2449, USA) was dissolved in DMSO (Solarbio ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Biophysics 2023Quote: 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphocholine (DOPC) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) stored in chloroform were purchased from Merck (Darmstadt, Germany) and stored under argon ...
-
bioRxiv - Neuroscience 2021Quote: ... and Pellet Paint Co-precipitant (Merck Millipore #69049-3). Genomic DNA traces were removed with DNA-free DNase Treatment and Removal Reagents (FisherScientific #AM1906 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1 M 3-Isobutyl-1-methylxanthine (IBMX; Merck, 15679), 50 mM DAPT (Merck ...
-
bioRxiv - Bioengineering 2019Quote: ... molecular weight cut-off 3 kDa (Amicon®, Merck) to a concentration of 1 mg/mL as determined by Qubit Protein Assay Kit (Invitrogen™ ...
-
bioRxiv - Biochemistry 2020Quote: ... using 3 kDa MWCO Amicon centrifugal filters (Merck Millipore). For protein denaturation ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), and interleukin 1β (IL1β ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), interleukin 1β (IL1β ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3 µM IWR-1 (MERCK, Cat. no. 681669). Glasgow’s MEM (GMEM)-based (Gibco ...