Labshake search
Citations for Merck :
101 - 150 of 1327 citations for IL 3 Mouse HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... nystatin (3 units/ml) (Merck: N1638) and ascorbic acid (500 μM ...
-
bioRxiv - Developmental Biology 2023Quote: ... or 3% Rabbit Serum (R9133, Merck)) and finally applying the conjugated antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (Merck; UK 28718-90-3) was included as a final wash stage ...
-
bioRxiv - Physiology 2024Quote: ... - 3% horse serum (Merck, ref H1270) PBS solution for 1 h ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 units/ ml nystatin (Merck: N1638) and 20 mM HEPES ...
-
bioRxiv - Bioengineering 2020Quote: ... and the membrane was incubated with primary antibody (anti-his tag, 1:1000, Merck Millipore, Merck KGaA, Darmstadt, Germany) diluted in 2 % skim milk for 1 hour ...
-
bioRxiv - Immunology 2022Quote: ... rh-HI was prepared in either 20% acetic acid (v/v from acetic acid glacial, Merck KGaA, Darmstadt, Germany), 0.3 M NaCl (Merck KGaA ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cdk1 and Cdc25B cDNAs were subcloned in frame with the N-terminal His-tag into pRSETa (Novagen, Merck Biosciences). Cdc25B cDNA was also subcloned into pcDNA3 without (pCdc25B) ...
-
bioRxiv - Cell Biology 2023Quote: ... Lysates were clarified by centrifugation (10,000 x g, 30 min, RT) and incubated for 1 hour with Ni-NTA His bind resin (Merck) rolling at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluates 1-3 were mixed and concentrated with Amicon Ultra-15 (Merck Millipore, MWCO 3 K) to protein concentrations of 44–162 µM.
-
bioRxiv - Genomics 2023Quote: ... then immersed in an amino-silane solution (3% vol/vol (3-aminopropyl) triethoxysilane (Merck cat no. 440140), 5% vol/vol acetic acid (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: ... GAPDH (mouse; Merck), FLAG (mouse ...
-
bioRxiv - Cell Biology 2019Quote: ... FLAG (mouse; Merck), FLAG (rat ...
-
bioRxiv - Neuroscience 2022Quote: ... FoxP2 (mouse, Merck Millipore ...
-
bioRxiv - Microbiology 2024Quote: ... Primary CD4+ T-cells were activated with 100U/μl of interleukin-2 (IL-2; Merck) and phytohemagglutinin-L (PHA-L ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 ug inactive MEK1 (C-terminally His-tagged) in a total volume of 40 μL buffer (20 mM Hepes pH 8 (MERCK, Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2022Quote: ... and applied directly onto a column of 2 ml pre-equilibrated Ni-NTA beads (cOmplete His-Tag Purification Resin from Merck). After several washes with high salt (500 mM NaCl) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the supernatant was loaded on to a gravity flow-based Ni-NTA metal affinity column (2 ml beads, cOmplete His-Tag Purification Resin from Merck), equilibrated and washed with 10 column volumes of buffer A containing 5 mM imidazole ...
-
bioRxiv - Biochemistry 2022Quote: ... The His6-tagged proteins were purified using Immobilised Metal Affinity Chromatography (IMAC) with Ni-NTA His•Bind® Resin (Merck). Fractions containing the protein of interest were then dialysed against low-salt (50mM Tris pH8.5 ...
-
bioRxiv - Biochemistry 2022Quote: ... The His6-tagged proteins were purified using Immobilised Metal Affinity Chromatography (IMAC) with Ni-NTA His•Bind® Resin (Merck). Fractions containing the protein of interest were then dialysed against low-salt buffer (50mM Tris pH7.0 ...
-
bioRxiv - Molecular Biology 2020Quote: ... WT—or its mutants fused with a His-tag on the amino-terminus—were expressed in Escherichia coli BL21 (DE3) using pET15b vector (Merck). A single colony was inoculated in 2 mL Luria-Bertani broth (LB ...
-
bioRxiv - Microbiology 2021Quote: ... The sonicated cellular extract was spun down and the supernatant has been incubated with His-binding resin (Merck 69670-5) for 10-30 min at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... His-tagged Trx1 was purified on a Ni2+ sepharose resin following the manufactureŕs instructions (cOmplete™ His-Tag Purification Resin, Merck).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The supernatant was passed through a 0.45 µM syringe filter before transferring into a tube containing HIS-Select Nickel Affinity Gel (Merck India) and kept on a mixer at 4°C for 3 h ...
-
Autorepression of Yeast Hsp70 co-chaperones by intramolecular interactions involving their J-domainsbioRxiv - Biochemistry 2024Quote: ... the supernatant was loaded onto a gravity flow-based Ni-NTA metal affinity column (2 ml beads, complete His-Tag Purification Resin from Merck), equilibrated and washed with 10 column volumes of buffer A containing 5 mM imidazole ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... was washed 3 times with PBS (Merck Millipore ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... 3-Indoleacetic acid (IAA, auxin) (Merck, I2886) and 1-Naphthaleneacetic acid (NAA ...
-
bioRxiv - Neuroscience 2020Quote: ... were primarily fixed in 3% glutaraldehyde (Merck) in 0.1 M sodium phosphate buffer with pH 7.2 at 4°C for 1 h and stored in a 0.1 M Na-phosphate buffer at 4°C until further analysis ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 3% sucrose (Merck KGaA; type number: 107687), and 30% apple juice (Edeka ...
-
bioRxiv - Immunology 2020Quote: ... Cells were fixed with 3% paraformaldehyde (Merck) and stained with anti-perforin Ab and phalloidin-AF 488 ...
-
bioRxiv - Immunology 2022Quote: ... Benzonase (15 U; Merck Millipore, 70664-3) and nuclease-free water served as positive and negative control ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µg of calf histones (Merck; H9250) was added ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Cell Biology 2022Quote: IBMX (3-Isobutyl-1-Methylxanthin – 15879 - Merck) and lidocaine (L7757 – Merck ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
Class IIa HDACs inhibit cell death pathways and protect muscle integrity in response to lipotoxicitybioRxiv - Cell Biology 2023Quote: ... 1S,3R-RSL 3 (Merck, Melbourne, Australia) and Ferrostatin (Selleckchem ...
-
bioRxiv - Genomics 2024Quote: ... scaffold and 3’-extensions (IDT or Merck). The pegRNA acceptor plasmid (Addgene #132777 ...
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... IL-10 concentrations were determined with MILLIPLEX MAP Porcine Cytokine/Chemokine Magnetic Bead Panel (Merck-Millipore) with strict adherence to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: ... The His6- tagged proteins were purified using Immobilised Metal Affinity Chromatography (IMAC) with 2mL Ni-NTA His•Bind® Resin (Merck), followed by incubation with TEV protease for 12 hours at 4 °C to remove the His6 tag ...
-
bioRxiv - Immunology 2020Quote: ... The elimination of the N-terminal His tag was performed through the cleavage with biotinylated thrombin included in the Thrombin Cleavage Capture Kit (Merck, Millipore) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Recombinant full length SIC proteins were purified using affinity chromatography with a His-bind column as per manufacturer’s instructions (Novagen, Merck, Darmstadt, Germany). sic1.300 ...
-
bioRxiv - Biochemistry 2022Quote: ... The His-tag-free Mpro in the flow-through was concentrated by using Amicon Ultra 15 centrifugal filters (10 kD, Merck Millipore) at 2773 x g ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse anti-GAPDH (Merck), and rabbit anti-actin (Santa Cruz ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...