Labshake search
Citations for Merck :
151 - 200 of 2177 citations for 7H Cyclopenta c pyridin 7 one 5 6 dihydro 3 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... pH 7.4) (final concentration: 12mg/mL) containing 5 μL Benzonase (final concentration: 1 μL benzonase/mL (MERCK, 71205-3). After dissolving ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked for 3 hr in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were permeabilized with 0.1% Triton X-100 for 3 minutes and then blocked with 5 or 10% bovine serum albumin (BSA, Merck) in PBS for 20 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked for 3 hours in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (TBST ...
-
bioRxiv - Genomics 2022Quote: ... in 3×250 ml bottles and resuspended in 100 ml prewarmed 30°C YPD supplemented with 50 ug/ml Pronase (Merck 10165921001), at which point the count-up for the time course was initiated ...
-
bioRxiv - Cell Biology 2022Quote: ... crescentus cultures were grown overnight at 30 °C in 3 ml of 2x PYE49 (Peptone, Merck, #82303; Yeast Extract, Merck, #Y1626) medium under mechanical agitation (200 rpm) ...
-
bioRxiv - Cell Biology 2022Quote: ... crescentus cultures were grown overnight at 30 °C in 3 ml of 2x PYE49 (Peptone, Merck, #82303; Yeast Extract, Merck, #Y1626) medium under mechanical agitation (200 rpm) ...
-
bioRxiv - Biochemistry 2021Quote: ... bacteria were grown to mid-logarithmic phase at 37 °C in 3% (w/v) tryptic soy broth (Merck KGaA, Darmstadt, Germany). The microbial culture was washed twice by centrifugation and re-suspended in fresh 10 mM Tris buffer (pH 7.4 at 37 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... with PBS pH 7.4 for 10 min at 4400 x g and 4°C using an Amicon Ultra-4 concentrator with 3 kDa cutoff (Merck Millipore). The degree of labelling (DOL = 1.96 ...
-
bioRxiv - Genetics 2022Quote: ... The tissue sections were then dried for 5 min at 37°C and mounted with 85% glycerol (Merck, 104094) and a coverslip ...
-
bioRxiv - Molecular Biology 2023Quote: ... Chromatin was enzymatically sheared for 5 min at 37°C with 0.2 mU/μL Micrococcal nuclease (MNase) (#N3755, Merck), and stopped with MNase stop buffer (110 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Microbiology 2024Quote: ... samples maintained at 4°C were eluted through a ZIC-pHILIC column (5 μm, polymeric, 150 by 4.6 mm; SeQuant, Merck) by mobile phase A (20 mM ammonium carbonate ...
-
bioRxiv - Biophysics 2020Quote: 19) Potassium chloride (KCl, Merck, CAS # 7447-40-7)
-
bioRxiv - Microbiology 2021Quote: ... Cuttings were transferred in magenta GA-7 vessels (Merck), incubated at 28°C ...
-
bioRxiv - Immunology 2022Quote: ... mouse CC1 Anti-APC (Ab-7) (#OP80-100UG, Merck) and mouse anti-Olig2 (#66513-1-IG ...
-
bioRxiv - Neuroscience 2022Quote: ... n-amyl acetate (AM; CAS: 628-63-7, Merck) diluted 1:20 in paraffin oil (CAS ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7% FBS (BioWest) and 10μg/mL Blasticidin hydrochloride (Merck)45.
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... either n-amylacetate (AM; CAS: 628-63-7, Merck, Darmstadt ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Physiology 2022Quote: ... and separation was carried out at 40°C using a ZIC-HILIC column (2.1 mm × 100 mm, 3 μm; Merck Sequant, Umea, Sweden). Isocratic elution was performed ...
-
bioRxiv - Cancer Biology 2021Quote: ... α6-integrin (Merck, monoclonal, MAB1378), Laminin V (Merck ...
-
bioRxiv - Developmental Biology 2023Quote: ... 6% PEG 4000 (Merck-Schuchardt), pH 5.0 ...
-
bioRxiv - Microbiology 2021Quote: ... Methyl viologen dichloride hydrate (paraquat, 98% purity) and Isopropil-β-D-1-tiogalactopiranósido (IPTG) were purchased from Merck.
-
bioRxiv - Neuroscience 2020Quote: ... and one 11μM nylon filter (NY1102500, Merck Millipore). The filtrate was centrifuged at 1500 rcf for 15 minutes at 4°C ...
-
bioRxiv - Biophysics 2022Quote: HEK293T cells were cultured in 10 cm tissue culture treated dishes grown at 37 °C in a 5% CO2 atmosphere in HEPES buffered DMEM/F12 1:1 (Merck) supplemented with 10% fetal bovine serum and 2 mM L-glutamine ...
-
bioRxiv - Microbiology 2021Quote: ... For detection of particle incorporation virus supernatant was further concentrated by centrifugation at 4°C for 2h at 21000xg on 5% Optiprep (Merck), the supernatant was removed and pellet was resuspended and subjected to Western Blot analysis ...
-
bioRxiv - Biochemistry 2019Quote: ... Nuclei were pelleted by centrifugation at 3000 rpm for 5 min at 4°C and were resuspended in hypotonic buffer containing 1U/µl of benzonase (Merck). Extracts were incubated on ice for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were stored at 4°C overnight before desilicification with 4% suprapure hydrofluoric acid (Merck; incubation of approximately 5 hours). Afterwards ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the plates were incubated at 33 °C in a 5% CO2 atmosphere in fresh medium with 0.25% Hoechst (Merck-Millipore) to stain the DNA ...
-
bioRxiv - Biochemistry 2023Quote: ... HeLa cells were cultivated at 37°C under 5% CO2 in MEM with Earle’s salts supplemented with 10% FBS superior (Merck KGaA), 2 mM L-Alanyl-L-Glutamine (Biochrom) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were washed three times with PBS and boiled for 5 min at 99°C in hot reducing SDS-buffer containing 2-mercaptoethanol (Merck).
-
bioRxiv - Developmental Biology 2022Quote: ... MII oocytes were activated for 6 h in Ca-free α-MEM medium containing 10 mM SrCl2 and 5 μM Latrunculin B (cat. no. 428020, Merck Millipore, Darmstadt, Germany). Following activation ...
-
bioRxiv - Molecular Biology 2020Quote: ... 7 were pooled together and concentrated to 1mL (UFC201024, Merck) and stored at −80°C.
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-HA-7 (Merck H9658; RRID:AB_260092; WB 1:20000) mouse anti-T7-tag (Merck 69522 ...
-
bioRxiv - Cell Biology 2020Quote: ... TE-7 (mouse, 1:200, Cat nb CBBL271, Merck, Sigma), Pax7 (mouse ...
-
bioRxiv - Neuroscience 2023Quote: ... inside a 7 mL KIMBLE Dounce tissue grinder set (Merck), using 10 strokes with loose pestle followed by 10 strokes with tight pestle ...
-
bioRxiv - Cancer Biology 2023Quote: ... and DEHP (1 µM, CAS no. 117-81-7, Merck) and the other was exposed by drinking water to the vehicle (absolute ethanol diluted at 1/106 in water) ...
-
bioRxiv - Immunology 2021Quote: ... The membrane was blocked using 1x TBST+ 3% Casein followed by overnight incubation at 4°C with biotinylated Lectin from Triticum Vulgaris (Sigma/Merck Cat. No. L5142). The membrane was washed with 1XTBST and further Incubated with Streptavidin PerCP-eFluor710 Conjugated ...
-
bioRxiv - Biochemistry 2023Quote: ... membrane using wet transfer for 3 h at 90 V/4 °C in transfer buffer (25 mM Tris; 192 mM glycine, Merck; 20% methanol, Merck). Afterwards ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Cell Biology 2023Quote: ... P1 virus was used to infect 50 ml of SF9 culture and P2 virus was harvested after 3-5 days through centrifugation and subsequent filtration through 0.45 μm PVDF membrane (Merck Millipore, SLHV033RS). P2 virus was either propagated further or stored at 4ºC in the dark ...
-
bioRxiv - Microbiology 2022Quote: ... To each tube 1 μL of Tris((1-benzyl-4-triazolyl)methyl)amine (TBTA) solution (2.5 mM in DMSO; Merck), 10 μL of Tetrakis(acetonitrile)copper(I ...
-
bioRxiv - Cell Biology 2023Quote: ... and then embedded in BMM resin (butyl methacrylate, methyl methacrylate, 0.5% benzoyl ethyl ether with 10 mM DTT (Merck)) at -20°C under UV light for polymerization ...
-
bioRxiv - Cell Biology 2020Quote: Flp-In™T-REx™293 and HEK293 cell lines were grown under standard conditions (37°C, 5% CO2) in Dulbecco’s modified Eagle’s medium (Merck-Sigma-Aldrich, D5796). For Flp-In™T-REx™293 the medium was supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Immunology 2020Quote: ... The pseudo-particle-containing supernatant was then concentrated to 5% of its original volume using an Amicon Ultra with a 100 KDa cutoff at 16 °C (Merck Millipore).