Labshake search
Citations for Merck :
1 - 50 of 2177 citations for 7H Cyclopenta c pyridin 7 one 5 6 dihydro 3 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 5(6)-Carboxyfluorescein (CF) (Merck; 100 mM CF stock ...
-
bioRxiv - Molecular Biology 2019Quote: ... from an 18500g centrifugation (6 min at +4°C) were run through 3-kDa cut-off centrifugal filters (Amicon Ultra-0.5 ml, Merck) into pre-weighted collection tubes to remove remaining macromolecules ...
-
bioRxiv - Immunology 2022Quote: ... approximately 5×105 Calu-3 cells were pre-treated with kp7-6 (100 ug/mL, CD95/CD95L antagonist, Merck) for 2 hour and then infected with SARS-CoV-2 at an MOI of 0.2 ...
-
bioRxiv - Immunology 2023Quote: ... Pepstatin A Methyl Ester (Pepstatin A, 516485) and MCC950 (256373-96-3) were purchased from Merck. Ultrapure™ DNase/RNase-Free Distilled Water (10977035 ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Microbiology 2020Quote: ... One sterile 5-mm glass bead (Merck KGaA, Darmstadt, Germany) was placed into each well prior to incubation in 37 °C shaking condition (100 rpm ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Biophysics 2020Quote: ... eluted as one fraction with 80% Acetonitrile and 5% Ammonia (Merck).
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Biochemistry 2023Quote: ... 400 μg of AtLEGβ or papain were inhibited with 0.5 mM or 5 mM S-methyl methanethiosulfonate (MMTS, Merck), respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Neuroscience 2022Quote: ... They were recorded in the presence of 10 mM CNQX (6-cyano-7-nitroquinoxaline-2,3-dione, Merck) and 50 mM D-AP5 (D-2-amino-5-phosphonovalerate ...
-
bioRxiv - Physiology 2023Quote: ... Blots were washed 3 x for 7 min with TBS-T (200 mM Tris (Merck), 1.36 mM NaCl (Merck) ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Microbiology 2023Quote: ... the solution was incubated at 30 °C for 90 min and then derivatized with 20 µl of N-methyl-N-trimethylsilyltrifluoroacetamide with 1% trimethylchlorosilane (Merck, USA) at 70 °C for 30 min54 ...
-
bioRxiv - Physiology 2020Quote: ... and embedded in methyl methacrylate (MMA; Merck). The received block was additionally referenced for further control with the milling of three opposing grooves.
-
bioRxiv - Genetics 2022Quote: ... 4 serial 10-fold dilutions of the viral stock were applied to each well of a 6-well mESC plate (MOCK plus 10−3 to 10−6) for transduction with 8 ng/μl polybrene (Merck). Two replicates were generated for each well ...
-
bioRxiv - Bioengineering 2023Quote: ... 30 mL Expi293 cultures were transfected with HER2 expression plasmid and the supernatant harvested 5-7 days later via centrifugation at 300 G for 5 minutes followed by filtration (Steriflip 0.22mm Merck, SCGP00525). HER2 was then purified from supernatant as previously described (Vazquez-Lombardi et al. ...
-
bioRxiv - Immunology 2020Quote: ... two STAT-3 inhibitors (STAT-3 inhibitor III (WP-1066) and STAT-3 inhibitor XIII (C-188-9) were tested (Merck, Sigma) and WP-1066 was used for infection studies at a final concentration of 12 μM ...
-
bioRxiv - Neuroscience 2022Quote: 6-7 dpf zebrafish larvæ were deeply anesthetized using 0.2% Ethyl3-aminobenzoate methanesulfonate (MS222; Merck KGaA, Darmstadt, Germany) diluted in EM ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Microbiology 2023Quote: ... We used sterile-filtered 3 % bovine serum albumin (BSA heat shock fraction, pH 7, > 98 %, Merck) in 1 × Pierce PBS buffer (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were derivatized for 1 hour at 85 °C using N-tert-Butyldimethylsilyl-N-methyl-trifluroacetamide with 1% tert-Butyldimethylchlorosilane (Merck, NJ, USA) and immediately analysed by GC-MS ...
-
bioRxiv - Immunology 2023Quote: ... and perfringens Types C and D (Vision 7 with SPUR, Merck Animal Health; Madison, NJ, USA). The cattle were also treated with fenbendazole (SafeGuard ...
-
bioRxiv - Physiology 2020Quote: ... 3.) C + 0.3 g/kg vitamin E (Merck KGaA, Darmstadt, Germany) (vit E diet) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: When the tumor sizes reached to 80 mm3 animals were treated with a PFKFB3 inhibitor 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one) (3PO) (Sigma-Aldrich, Merck, Overijse, Belgium). The animals received intraperitoneal (i.p. ...
-
bioRxiv - Cell Biology 2021Quote: ... After blocking for one hour in PBST with 5% normal goat serum (Merck G9023) and 0.1% BSA ...
-
bioRxiv - Neuroscience 2023Quote: ... and stained with 5 µM 4′,6-diamidino-2-phenylindole (DAPI) (Merck) in PBS if required ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 μM 6-benzylaminopurine (BAP; Merck Life Science UK Ltd., Gillingham, UK) (0.1% v/v Tween20) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pH 7 using repetitive washing and centrifugation with an Amicon 3 kDa MWCO centrifugal filter (Merck Millipore). For the synthesis of ditopic A’-A’ CC ligand ...
-
bioRxiv - Biophysics 2022Quote: ... and were dissolved in a mixture of chloroform / methanol (7:3 vol/vol, both from Merck KGaA) to yield four stock solutions at 1.5 mM lipid concentration ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Neuroscience 2022Quote: ... was combined with 90μM sygRNA (5’ - GGATTTGGTAATAGCAG AGGGGG 3’) (Merck) at RT for 15 minutes to form an RNP complex ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA oligonucleotide G4A4 (5’-AAAAAAGGGGAAAAGGGGAAAAGGGGAAAAGGGGAAAAAA-3’) was purchased from Merck. CD analysis of 2,5 µM RNA was carried out in the buffer used for G4-pulldown ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... oocytes were incubated for one to three days at 19°C in 50% Leibowitz medium (Merck) supplemented with 0.25 mg/ml gentamicin ...
-
bioRxiv - Biophysics 2024Quote: ... cell were treated with 5 µg/mL Mitomycin C (Merck) for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... WT mice were 7-8 week-old Mice (C57BL/6 WT or Nr4a3-Timer-GS) were injected with 10 mg/kg azoxymethane (Merck) via i.p ...
-
bioRxiv - Systems Biology 2020Quote: Wnt signal inhibitor (CK) stock (2.4–3 mM): CKI-7 dihydrochloride (#C0742-5MG, Merck & Co., Inc., NJ, USA) diluted in distilled water (Otsuka Pharmaceutical Factory ...
-
bioRxiv - Bioengineering 2019Quote: ... The supernatant was passed through the cartridges (pre-conditioned with 5 mL each of tert-methyl butyl ether, methanol (Merck; laboratory grade purity) and deionised water ...
-
bioRxiv - Microbiology 2022Quote: A CRISPR array containing 6 identical spacers targeting the tetR gene flanked by 7 repeats was cloned into pCDF-Duet (Novagen, Merck Millipore) by ligation after NcoI and SalI digestion ...
-
bioRxiv - Microbiology 2022Quote: ... mouse α-c-Myc antibodies (2.5 to 5 µg/ml; Merck), or mouse α-CSP 3D11 monoclonal antibodies (6 ...
-
bioRxiv - Biophysics 2020Quote: ... one cycle for 5 min) in Amicon Ultra 100 kDa MWCO filters (Merck Millipore, Darmstadt, Germany) using reaction buffer (25 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Microbiology 2020Quote: ... The internal standard was 1 μL of methyl heneicosanoate (10 mg/mL) and Bacterial acid methyl ester (BAME) mix (Merck-Millipore, Burlington, MA, USA) was used to identify the each peak of fatty acids and analytical standards for each fatty acid were used for quantification.
-
bioRxiv - Plant Biology 2020Quote: DSF (cis-11-methyl-2-dodecenonic) was purchased from Merck and dissolved in DMSO to obtain 100 mM stock ...