Labshake search
Citations for Merck :
151 - 200 of 2420 citations for 4 Amino 3 8 dichloro 5 methoxyquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Bioengineering 2023Quote: ... 8 μg/mL Calcein AM (Merck, Germany), 4 μg/mL PI (Merck ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.001% phenol red (Merck, 143-74-8), pH 7.8) ...
-
bioRxiv - Immunology 2021Quote: ... Histone neutralisation experiments were performed via intraperitoneal injection with dialysed and combined a-Histone 3 and a-Histone 4 antibodies (Merck Millipore) or control polyclonal rabbit IgG (BioXCell) ...
-
bioRxiv - Biophysics 2019Quote: ... Fragments (2 mM in DMSO) were injected (2 μL) onto a Purospher STAR RP-18 end-capped column (3 μm, 30 × 4 mm, Merck KGaA). Chromatographic separation was carried out over a 4-min gradient elution (90:10 to 10:90 water:methanol ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was then concentrated to 100-200 μL using centrifugal filter units with a 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) by centrifugation at 5000 g at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... the supernatant from late-log cultures was concentrated to <100 μL and washed (with 400 μL of ddH2O) in 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) using centrifugation at 5000 g ...
-
bioRxiv - Microbiology 2024Quote: ... samples maintained at 4°C were eluted through a ZIC-pHILIC column (5 μm, polymeric, 150 by 4.6 mm; SeQuant, Merck) by mobile phase A (20 mM ammonium carbonate ...
-
bioRxiv - Genomics 2024Quote: ... media was changed for 500 µL of DMEM +5% FBS +4 μg/mL of polybrene (Merck TR-1003-G). Lentiviruses were diluted to the desired MOI in 500 µL of DMEM +5% FBS and slowly added to each well ...
-
bioRxiv - Neuroscience 2021Quote: ... 10mM Hepes and 1% MEM amino acids (all obtained from Merck, Darmstadt, Germany). Cells were grown for two weeks ...
-
bioRxiv - Developmental Biology 2022Quote: ... 32.8 mM 20:4 and 60 mM 22:6) and pipetted dropwise into N2 media containing 3 mM fatty acid-free BSA (Merck, Cat. #A8806) at 37°C with constant stirring to obtain final concentrations of 3 mM 18:0 ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were mounted in CitiFluor™ CFM3 mounting medium (proSciTech, Australia) containing 3 μg/uL 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Merck, Germany) to stain nucleic acids ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... rat slices were exposed to 3 μM dihydroethidium (DHE) while in humans’ sections it was added 4 μM DHE (Merck, Darmstadt, Germany) for 30 minutes at 37ºC 51 ...
-
bioRxiv - Cell Biology 2023Quote: ... P1 virus was used to infect 50 ml of SF9 culture and P2 virus was harvested after 3-5 days through centrifugation and subsequent filtration through 0.45 μm PVDF membrane (Merck Millipore, SLHV033RS). P2 virus was either propagated further or stored at 4ºC in the dark ...
-
bioRxiv - Microbiology 2020Quote: ... 5×106 cells from treated and untreated conditions were centrifuged for 5 min at 4,500 g and the pellets were resuspended in 4% paraformaldehyde (PFA, Merck, Germany), and incubated for 20 min ...
-
bioRxiv - Microbiology 2021Quote: ... For detection of particle incorporation virus supernatant was further concentrated by centrifugation at 4°C for 2h at 21000xg on 5% Optiprep (Merck), the supernatant was removed and pellet was resuspended and subjected to Western Blot analysis ...
-
bioRxiv - Biochemistry 2019Quote: ... Nuclei were pelleted by centrifugation at 3000 rpm for 5 min at 4°C and were resuspended in hypotonic buffer containing 1U/µl of benzonase (Merck). Extracts were incubated on ice for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... equipped with a LiChrospher® 100 RP-18 (125 mm x 4 mm, 5 µm) C18 reversed-phase column (Merck). The elution solvents consisted of ultrapure water with 0.1% formic acid (A ...
-
bioRxiv - Cell Biology 2021Quote: ... 8 µg/mL D-pantothenic acid (Merck, P5155), 1 µM rosiglitazone (Merck ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-Mad1 clone BB3-8 (1:1000, Merck), anti-ZW10 (Rabbit ...
-
bioRxiv - Molecular Biology 2023Quote: ... incubated with 8 mg/mL Polybrene Reagent (Merck) for 1h ...
-
bioRxiv - Biophysics 2021Quote: Fmoc (9-fluorenylmethyloxycarbonyl)-amino acids were obtained from Novabiochem (Merck Biosciences, La Jolla, CA). Rink amide MBHA resin (0.65 mmol/g ...
-
bioRxiv - Bioengineering 2022Quote: ... and MEM non-essential amino acid solution (100x) were purchased from Merck (Darmstadt, Germany). L-glutamine (200 mM) ...
-
bioRxiv - Immunology 2021Quote: ... The membrane was blocked using 1x TBST+ 3% Casein followed by overnight incubation at 4°C with biotinylated Lectin from Triticum Vulgaris (Sigma/Merck Cat. No. L5142). The membrane was washed with 1XTBST and further Incubated with Streptavidin PerCP-eFluor710 Conjugated ...
-
bioRxiv - Cell Biology 2022Quote: ... shMYO10 #3 and shMYO10 #4 cell lines were generated using lentiviruses particles containing a non-target control shRNA (Merck, Cat Number: SHC016V-1EA) or shRNA targeting human MYO10 respectively (shMYO10 #3 ...
-
bioRxiv - Biochemistry 2022Quote: ... Loss of Memo was induced by 3 daily intraperitoneal injections with 2mg tamoxifen at age 4 weeks (T5648 Sigma-Aldrich, distributed through Merck, Buchs Switzerland). Memofl/fl littermates without Cre but treated with tamoxifen served as controls ...
-
bioRxiv - Biochemistry 2023Quote: ... membrane using wet transfer for 3 h at 90 V/4 °C in transfer buffer (25 mM Tris; 192 mM glycine, Merck; 20% methanol, Merck). Afterwards ...
-
bioRxiv - Cell Biology 2023Quote: ... For NMR-experiments the proteins were concentrated by repeated ultrafiltration (Amicon Ultra-4 Ultracel-3 kDa centrifugal filter device, Merck Millipore, Burlington, USA).
-
bioRxiv - Microbiology 2021Quote: ... protease cleavage site at the N-terminus site was subcloned between KpnI (5’-terminus) and HindIII (3’-terminus) restriction enzyme sites in the pRSF-1b vector (Merck, Darmstadt, Germany) to express His-TEV protease site-MA protein (pRSF-1b_MA ...
-
bioRxiv - Biochemistry 2023Quote: ... dehydrated with 100 μL acetonitrile and rehydrated with 25 μL trypsin solution, containing 5 ng/μL trypsin (cat # 37283, SERVA Electrophoresis GmbH, Heidelberg) in 3 mmol/L ammoniumbicarbonate (cat # 09830, Merck KGaA, Darmstadt). After 4 h incubation at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... fixed with 2% paraformaldehyde (PFA) in PHEM and washed once for 5 min at (RT) with 3% BSA (bovine serum albumin, Merck-Sigma, Germany) in Tris-buffered saline with 10 mM EGTA and 2 mM MgCl2 (TBSTEM) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3% casein (Merck) in 20 mM TBS (pH 11.0) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nutlin-3 (Merck) was dissolved in DMSO and diluted in saline.
-
bioRxiv - Microbiology 2019Quote: ... Cells were then fixed with 4% p-formaldehyde (PFA) during 15 min and stained with DAPI (5 min, 1 μg/ml in PBS; Merck-Millipore).
-
bioRxiv - Plant Biology 2019Quote: ... resuspended in 5 ml 10 mM Sodium-acetate (pH 5.0) and concentrated with Amicon Ultra-4 Centrifugal Filter Units (Merck Millipore, 10K) ∼10 fold ...
-
bioRxiv - Molecular Biology 2021Quote: ... was centrifuged at 1500 rpm for 10 mins and the supernatant was used to measure inflammatory cytokines (IL-4, IL-5, IL-13, γ-INF) by LUMINEX multi-factor detection (MERCK). The cell pellets were fixed in 4% formaldehyde for Wright-Giemsa staining and total cells were counted and classified in each slide.
-
bioRxiv - Systems Biology 2020Quote: TGF-β/Activin/Nodal signal inhibitor (SB) stock (4–5 mM): SB 431542 hydrate (#S4317-5MG, Merck & Co., Inc., NJ, USA) diluted in DMSO (#D2650-5×5ML ...
-
bioRxiv - Cancer Biology 2024Quote: ... After 30 minutes of incubation 100 μL of 2X STOP buffer (NaCl 340 mM, EDTA 20 mM, EGTA 4 mM, 5% Digitonin, 100 μg/mL RNase A (Merck, R6513), 50 μg/mL Glycogen (Thermo Scientific ...
-
bioRxiv - Immunology 2024Quote: ... U-937 cells were maintained in RPMI-1640 medium supplemented with 4.5 g/L glucose, 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, 1.0 mM sodium pyruvate (Sigma-Aldrich; Merck KGaA), 10% fetal bovine serum (Hyclone ...
-
bioRxiv - Neuroscience 2022Quote: ... and 4-aminopyridine (4-AP) (100 μM, Merck) was bath perfused to isolate direct monosynaptic inputs during photostimulation.
-
bioRxiv - Microbiology 2022Quote: ... the supernatants were concentrated 50-fold using Amicon Ultra-4 centrifugal filters with a molecular weight cut-off of 3 kDa (Merck-Millipore, Burlington, MA, USA). Samples were mixed with 3× Laemmli loading buffer and heated for 3 min at 85 °C before SDS-PAGE analysis ...
-
bioRxiv - Microbiology 2022Quote: ... mice were gavaged with 0.2 ml of Fluorescein Isothiocyanate-Dextran (FITC-Dextran; 3–5 kDa; cat. no. FD4; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) in PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... The flow through and wash fractions were concentrated to 3-5 mg/mL using Amicon ultrafiltrators (10 kDa MWCO, Merck Millipore, Darmstadt, Germany). All fractions were combined and dialyzed 2x over night at 4 °C against 5 L 10 % (v/v ...
-
bioRxiv - Systems Biology 2022Quote: ... or 8 M Urea (Merck Sigma, Cat. No. U5378) and phosphatase/protease inhibitors ...
-
bioRxiv - Bioengineering 2022Quote: ... in 150 mM NaHCO3 buffer (Merck, #144-55-8) with a pH of 11 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2.25ml of BSA solution 35% (Merck 9048-46-8).