Labshake search
Citations for Merck :
1 - 50 of 2420 citations for 4 Amino 3 8 dichloro 5 methoxyquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... 4-amino pyridine (5 mM, Merck) and TTX (0.5-1 μM ...
-
Highly amine-reactive graphene-oxide EM grids for biochemical surface modification in aqueous bufferbioRxiv - Molecular Biology 2023Quote: ... 4-Amino-1-butanol (#178330) and 3- glycidoxypropyltrimethoxysilane (#440167) were obtained from Merck. Gold nanoparticle- PEG-amine conjugate was custom-synthesized by NanoPartz (Loveland CO ...
-
bioRxiv - Immunology 2019Quote: ... the inhibitor 6-amino-4–4-phenoxyphenylethylamino-quinazoline (Merck Millipore, USA) was reconstituted in DMSO at a stock concentration of 1mM and administered at a final concentration of 10nM on Days 0 and 4 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
bioRxiv - Genomics 2023Quote: ... then immersed in an amino-silane solution (3% vol/vol (3-aminopropyl) triethoxysilane (Merck cat no. 440140), 5% vol/vol acetic acid (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ cyclic mono-phosphate (8-Br-cAMP, Merck B5386) and 1 μM medroxyprogesterone acetate (MPA ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Physiology 2021Quote: ... Membranes blocked with 5% non-fat milk in PBS-T or Tris-Buffered Saline TBS (TBS-T) (RT, 60min) and immunoblotted using the following primary antibodies (4°C, overnight): rabbit anti-pSmad1/5/8 (Merck Millipore, AB3848), rabbit anti-pSmad2 (Cell Signaling ...
-
bioRxiv - Cell Biology 2023Quote: ... plates were treated with 3-amino-propyltrimethoxysilane (diluted 1:2 with PBS; Sigma-Aldrich/Merck) for 15min at RT ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Microbiology 2024Quote: ... and mixed 4 g of it in 8 mL of DMSO (Merck). The DMSO-soluble fraction of Enteropan was found to be 71.17% ± 3.07 ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Cell Biology 2023Quote: ... The blots were developed in a solution of nitroblue tetrazolium chloride (NBT) and 5-brom-4-chlor-3-indoxylphosphate (BCIP; Merck, Darmstadt, Germany) for 5–30 min at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Neuroscience 2021Quote: ... the kinetics of ROS production was evaluated for 2 h after the addition of 2,7-dichloro-diidrofluorescineacetate (DCFH-DA, Merck, Darmstadt, Germany) using the Microplate Reader GloMax fluorimeter (Promega Corporation ...
-
bioRxiv - Plant Biology 2021Quote: ... Pure standards of (Z)-3-hexenyl acetate (Z3HAC, 98 %, CAS number 3681-71-8, Merck) was used in different concentrations ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Neuroscience 2022Quote: ... was combined with 90μM sygRNA (5’ - GGATTTGGTAATAGCAG AGGGGG 3’) (Merck) at RT for 15 minutes to form an RNP complex ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA oligonucleotide G4A4 (5’-AAAAAAGGGGAAAAGGGGAAAAGGGGAAAAGGGGAAAAAA-3’) was purchased from Merck. CD analysis of 2,5 µM RNA was carried out in the buffer used for G4-pulldown ...
-
bioRxiv - Microbiology 2022Quote: ... 2-heptyl-3- hydroxy-4(1H)-quinolone (PQS) (Sigma Aldrich, Merck Life Science ...
-
bioRxiv - Genetics 2022Quote: ... or SD complete amino acid agar (0.67% yeast nitrogen base with amino acids (Merck), 2% glucose ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: OCT-embedded penis sections from humans and rats of 6-8 μm were cut in a cryostat and incubated with or without 4-Hydroxi-TEMPO (4-TEMPOL; Merck, Darmstadt, Germany) 10mM for 30 minutes ...
-
bioRxiv - Physiology 2020Quote: ... at 4°C for 60 min using an Amicon Ultra-4 3 kDa centrifugal filter device (Merck Millipore). The 50 μL retentate was the final volume of concentrated EVs ...
-
bioRxiv - Neuroscience 2024Quote: ... 9-β-D-Ribofuranosyladenine (adenosine) and (S)-(+)-a-amino-4-carboxy-2-methylbenzeneacetic acid (LY-367385) were purchased from Merck.
-
bioRxiv - Cell Biology 2022Quote: ... cells were treated for 48 h with 3 μM 4-hydroxytamoxifen (Merck) and then kept in 300 nM until experimentation ...
-
bioRxiv - Immunology 2021Quote: ... Calu-3 cells were transduced by addition of lentiviral supernatants containing 8 μg/ml polybrene (Merck Darmstadt). 48 hours after transduction ...
-
bioRxiv - Biochemistry 2019Quote: ... Fmoc-protected amino acids (Merck Millipore) and amino-modified acid-stable cellulose membranes with PEG-spacers (Intavis ...
-
bioRxiv - Synthetic Biology 2020Quote: ... amino-acid standards (Merck, Darmstadt, Germany) were analyzed under the same conditions in order to determine typical retention times.
-
bioRxiv - Synthetic Biology 2021Quote: ... Amino-acid standards (Merck, Darmstadt, Germany) were used to determine specific retention times.
-
bioRxiv - Synthetic Biology 2022Quote: ... Amino acid standards (Merck, Darmstadt, Germany) were analyzed beforehand to determine typical retention times.
-
bioRxiv - Cell Biology 2023Quote: ... 1 % non- essential amino acids (Merck) and GlutaMAX™ (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % non- essential amino acids (Merck) and GlutaMAX ™ (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2019Quote: ... The cells were passaged per 3–5 days using Accutase (Merck-Millipore), mechanically scraped ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were sub-cultured on days 4 and 8 of differentiation onto human fibronectin (Merck Millipore, #FC010) coated plates at a ratio of 1:4 ...
-
bioRxiv - Microbiology 2024Quote: ... 0.5 mL of a UPLC-grade water:methanol (3:1, v/v) solution with 1:500 diluted 13C-and 15N-labeled amino acids standard mix (Sigma-Aldrich, Merck, Darmstadt, Germany) was added to the tubes ...
-
bioRxiv - Neuroscience 2022Quote: ... with PBS pH 7.4 for 10 min at 4400 x g and 4°C using an Amicon Ultra-4 concentrator with 3 kDa cutoff (Merck Millipore). The degree of labelling (DOL = 1.96 ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transduced with sgRNA lentiviruses at an MOI of 3 with 8 µg ml−1 Polybrene (Merck-Millipore) for 4 hours and then reprogramming was initiated by addition of reprogramming medium ...
-
bioRxiv - Developmental Biology 2019Quote: ... The cells were blocked in 3% BSA (Applichem) and 5% donkey serum (Merck) in PBS for 2 hours at RT ...