Labshake search
Citations for Merck :
151 - 200 of 5041 citations for 1 3 Fluorophenyl 5 oxopyrrolidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... scaffold and 3’-extensions (IDT or Merck). The pegRNA acceptor plasmid (Addgene #132777 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Microbiology 2024Quote: ... and 3% Normal Goat Serum (Merck, S26)) for 1h at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... containing 3 mg/ml collagenase P (Merck), 1 mg/ml collagenase B (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2024Quote: ... or 3% Normal donkey serum (NDS, Merck), 2%BSA (NACALAI TESQUE) ...
-
bioRxiv - Immunology 2024Quote: ... we included αTIM-3+ αPD-1 and used anti-human RSV-IgG4 as an isotype control antibody (5 μg/mL, 60AGK S228P, Merck & Co., Inc., Rahway, NJ, USA). On day six ...
-
bioRxiv - Cell Biology 2020Quote: ... Primary antibodies used were CYFIP1/2 (Sra-1/PIR121 [14], Rac1/3 (23A8, Merck), Nap1 [14] ...
-
bioRxiv - Molecular Biology 2022Quote: ... faecalis was diluted 1:100 into 3 L of Brain heart infusion (BHI, Merck) and grown at 37°C ...
-
bioRxiv - Biophysics 2024Quote: ... 1 mM DTT) and concentrated using a 3 kDa MWCO Centriprep concentrators (Merck Millipore). For best performance in the iSAT reaction ...
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Biochemistry 2024Quote: ... and 3 μL (equivalent to 3 mg cell dry weight) were spotted on HPTLC silica gel 60 plates (Merck) and developed in chloroform/methanol/13 M NH3/1 M NH4Ac/water (180:140:9:9:23 ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked for 3 hr in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (Merck ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked for 3 hours in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (TBST ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were permeabilized with 0.1% Triton X-100 for 3 minutes and then blocked with 5 or 10% bovine serum albumin (BSA, Merck) in PBS for 20 minutes ...
-
bioRxiv - Immunology 2022Quote: ... approximately 5×105 Calu-3 cells were pre-treated with kp7-6 (100 ug/mL, CD95/CD95L antagonist, Merck) for 2 hour and then infected with SARS-CoV-2 at an MOI of 0.2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... each coverslip was washed with PBS 3 times each for 5 minutes and nuclei were stained with Hoechst (Merck Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Neuroscience 2024Quote: ACS was prepared from astrocyte cultures with aNSPC medium and filtered with a 3 kDa filter (Amicon Ultra-4 centrifugal Filter 3 kDa MWCO, Merck UFC8003243 to obtain a < 3 kDa and a > 3 kDa fraction ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (BSA, Merck/Sigma-Aldrich) in PBS was added as blocking buffer and incubated for 1 hour ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...
-
bioRxiv - Plant Biology 2024Quote: ... protoplasts were treated with 3 µM DAPI (Merck) overnight ...
-
bioRxiv - Microbiology 2024Quote: ... 3 rounds of phenol-chloroform-isoamyl alcohol (Merck) extraction were performed using 15 ml gel-lock tubes (QIAGEN) ...
-
bioRxiv - Immunology 2020Quote: ... rAAVDJ or rAAV6 genome plasmid and Donor plasmid at a 3:1:1 ratio in Polyethylenimine (PEI)(Merck). In total each plate was teransfected with 41,250ng of DNA ...
-
bioRxiv - Cell Biology 2021Quote: ... slides were washed 3×10 min in PBS and counterstained with PI (Merck, 1:500) and p-Phenylenediamine dihydrochloride (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... and 188 μM L-α-phosphatidylcholine: L-α-phosphatidylinositol PC:PI (3:1) (Merck, Darmstadt, DE). 1.5 ml of 0.1 M potassium phosphate buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... plates were treated with 3-amino-propyltrimethoxysilane (diluted 1:2 with PBS; Sigma-Aldrich/Merck) for 15min at RT ...
-
bioRxiv - Neuroscience 2023Quote: For conditioning the odors 4-MCH (1:250, Merck, Darmstadt, Germany,CAS #589-91-3) and 3-OCT (1:167 ...
-
bioRxiv - Plant Biology 2024Quote: ... at a dilution of 1:1000 in 3% BSA and 0.5% Triton X-100 (Merck) overnight (o/n) ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 µg 17:0 free fatty acid (Merck, Germany) was used as the internal standard ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-total-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (anti-tAMPAR) (Cat.#AB1504, Merck Millipore, Burlington, MA, USA), anti-phospho (Ser845)-AMPAR (anti-pAMPAR;cat.#AB5849 ...
-
bioRxiv - Microbiology 2024Quote: ... hsa-miR-21-5p scramble microRNA mimic and a double-stranded small RNA oligonucleotide control (sequence: 5’- GGAACGCCAACCGAAGUCUA - 3’) (all from Merck) were added to achieve a final concentration of 250 nM on each well ...
-
bioRxiv - Biochemistry 2024Quote: Lipids (1 mg from the brain and 3–5 mg from the testis) were separated via TLC (Silica Gel 60 TLC plate, Merck) with methyl acetate/2-propanol/chloroform/methanol/0.25% calcium chloride in water (25:25:25:10:9 ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by signal development for 6–24 h in a solution containing nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Merck). The samples were covered with glass coverslips using CC/Mount (Merck) ...
-
bioRxiv - Cancer Biology 2024Quote: ... at a multiplicity of infection (MOI) of 2–3 in the presence of 5 µg/ml polybrene (Hexadimethrine bromide, Merck). For creating stable SCC13 cell lines expressing YAP- or TAZ-targeting shRNAs ...