Labshake search
Citations for Merck :
1901 - 1950 of 2064 citations for 5 M TOLYL FURAN 2 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: GMPCPP-stabilized microtubules were grown using a mixture of 1.3 mg ml−1 tubulin and 2 mM GMPCPP (Merck, NU-405L) in BRB80 and incubated for 1 hour (stepping and photobleaching assay ...
-
bioRxiv - Neuroscience 2021Quote: ... brains were quickly removed from the skull and snap frozen at −25°C in isopentane (2-Methylbutane, Merck Life Science, Italy). Once frozen ...
-
bioRxiv - Developmental Biology 2022Quote: ... Organoid cells were cultured in self-renewing medium with ROCKi for 8 days before Dox (Doxycycline hyclate, 2 µg/ml, Merck, D9891) and TMP (Trimethoprim ...
-
Trypanosoma brucei J protein 2 functionally cooperates with the cytosolic Hsp70.4 and Hsp70 proteinsbioRxiv - Molecular Biology 2019Quote: ... 2 mM MgCl2) or into the appropriate assay buffer for functional studies and then subsequently concentrated against PEG 20000 (Merck, Germany). The protein yield was estimated using the Bradford assay (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2019Quote: ... 500 μL of phage suspension (2 × 1010 PFU·mL-1) was mixed with 500 μL of extra pure chloroform (Merck Millipore™) and kept under 250 rpm·min-1 for 1 hour ...
-
bioRxiv - Plant Biology 2019Quote: ... Pelet was dissolved in 2 ml DDW and passed through a 0.2-μm membrane filter (Millex-GV Filter Unit, Merck Millipore, Ireland). The filtrate was used for sucrose ...
-
bioRxiv - Neuroscience 2020Quote: ... cryoprotected for 48 h in 20% sucrose at 4°C and then snap frozen in isopentane (2-methylbutane, Merck GmbH, Austria) for 3 min at −60°C ...
-
bioRxiv - Neuroscience 2020Quote: ... a buffer suitable to investigate aggregates resistance to digestion (detailed below) and 2) the SysQuant Buffer (8M urea, phosphatase inhibitor (PhosSTOP™, Merck) and protease inhibitor (cOmplete™ ...
-
Dual signaling via interferon and DNA damage response elicits entrapment by giant PML nuclear bodiesbioRxiv - Microbiology 2021Quote: ... PAb directed against phospho-STAT2 (Tyr689) and MAb directed against human IFNα/β receptor chain 2 (MAB1155) were purchased from Merck-Millipore.
-
bioRxiv - Bioengineering 2021Quote: Unbound DNA was removed from DNA-SWCNT samples prepared by direct sonication and MeOH-assisted surfactant exchange by rinsing with Amicon centrifugal ultra-filtration devices (Amicon Ultra-2, Sigma Aldrich, 100 kDa membrane, Merck), as detailed above ...
-
bioRxiv - Bioengineering 2021Quote: ... and GEES protein fractions (2-16 µg) were processed by the MED-FASP protocol using Microcon 30k centrifugal ultrafiltration units (Merck, Darmstadt) [11] ...
-
bioRxiv - Biochemistry 2020Quote: ... Next the medium was replaced with a serum-free media supplemented with 2 nM brain-derived neurotrophic factor (BDNF) (Merck Millipore). After 2 days in the BDNF-containing media ...
-
bioRxiv - Neuroscience 2021Quote: ... The brains were removed and post-fixed for 1-2 days and then transferred to 30% sucrose (Merck KGaA, Darmstadt, Germany) dissolved in PBS ...
-
bioRxiv - Neuroscience 2020Quote: The barrier integrity of the in vitro BBB models was assessed through measurements of TEER using Millicell ERS-2 epithelial volt-ohm Meter and STX01 Chopstick Electrodes (Merck Millipore). The TEER value for each hanging culture insert was obtained from an average of three individual measurements subtracted the TEER value of a double-coated cell-free hanging culture insert and multiplied by the area of the hanging culture insert (1.12cm2) ...
-
bioRxiv - Plant Biology 2022Quote: CGMMV vsiRNAs were quantified by RT-qPCR according to Shi and Chiang (2005) with some modifications: 2 μg of RNA extracts from the cucumber leaves were treated with DNaseI (Merck, Spain) and polyadenylated using the Poly(A ...
-
bioRxiv - Immunology 2020Quote: PBMCs were rested overnight in complete medium and seeded at 2 × 105 cells/well in MultiScreen HTS Filter Plates (Merck Millipore) pre-coated with anti-IFN-γ (clone 1-D1K ...
-
bioRxiv - Microbiology 2021Quote: ... All samples were further concentrated to a final volume of 1-2 ml using 100 kDa Amicon-ultra filters (Merck Millipore).
-
bioRxiv - Cell Biology 2022Quote: ... The eluate of the affinity purification was concentrated to a volume between 1-2 mL before injection using centrifugal filter units (Amicon, Merck millipore) with a MWCO of 10 kDa ...
-
bioRxiv - Neuroscience 2022Quote: ... Slices were subsequently washed with PBS and incubated for 2 h with the proper secondary antibodies (1:300, goat anti-rabbit Alexa-Fluor® 647, AP187SA6, Merck Millipore ...
-
bioRxiv - Biophysics 2022Quote: The dyes used in this study and the working dilutions were: 6-Dodecanoyl-N,N-dimethyl-2-naphthylamine (LAURDAN, 4.5 μM, Sigma-Aldrich, Merck, #40227), Hoechst 33342 (80 uM ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Growth experiments were performed on YNB medium with 1 or 2 % methanol supplemented with 1 g/L yeast extract (Merck 103753). Optical density readings at 600 nm (OD600 ...
-
bioRxiv - Biophysics 2019Quote: ... Fragments (2 mM in DMSO) were injected (2 μL) onto a Purospher STAR RP-18 end-capped column (3 μm, 30 × 4 mm, Merck KGaA). Chromatographic separation was carried out over a 4-min gradient elution (90:10 to 10:90 water:methanol ...
-
bioRxiv - Plant Biology 2020Quote: ... tumefaciens were resuspended in 50 mM MES (2-Morpholinoethanesulfonic acid hydrate) (Duchefa, Haarlem, The Netherlands) - KOH buffer (pH 5.6) containing 2mM NaH2PO4 (Merck, Darmstadt, Germany), 100 µM acetosyringone (Sigma-Aldrich ...
-
bioRxiv - Paleontology 2020Quote: All aqueous solutions were prepared from ultrapure grade water obtained by water filtration with a two stages Millipore system (Milli-Q® Academic with a cartouches Q-Gard 1 and Progard 2, Merck Millipore ...
-
bioRxiv - Microbiology 2020Quote: ... used for barrier dysfunction experiments were conducted on a 37 °C heating block using a Millicell ERS-2 Voltohmmeter (Merck-Millipore) equipped with an Ag/AgCl electrode (STX01) ...
-
bioRxiv - Molecular Biology 2021Quote: TEER measurements [22] were performed on 3rd day of incubation with growth factors and (or) different inhibitors by using Millicell ERS-2 Electrical Resistance System (Merck-Millipore). Each insert was measured in three different locations ...
-
bioRxiv - Molecular Biology 2020Quote: ... we repeated the experimental protocol and behavioral battery in wild type zebrafish larvae using 2 μM THC (Merck, Cat. No. T4764), and 0.15 μM nicotine (Sigma ...
-
bioRxiv - Biochemistry 2019Quote: ... Fractions containing the desired His6-tagged protein were concentrated to 2 ml using Amicon® Ultra Centrifugal Filters (10,000 MWCO, Merck Millipore), and were directly injected into a size-exclusion chromatography column (Superdex 75 16/60 ...
-
bioRxiv - Biochemistry 2020Quote: ... The lipids were resuspended in a small volume of chloroform/methanol (2:1) and applied to a to HPTLC plate (Silica Gel 60, Merck, Germany) together with DOPC/cholesterol and NeuGc/NeuAc GM3 as standards ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and 2 μl of the enzyme β-glucuronidase (from Helix from Pomatia enzyme aqueous solution, ≥ 100.000 units/mL; Merck, Darmstadt, Germany) to deconjugate DEHP metabolites and BPA ...
-
bioRxiv - Microbiology 2020Quote: ... and the other stored at −80 °C in a sterile 2 ml cryovial containing 1 ml of a 30 % glycerol solution, prepared by diluting glycerol (≥99 %, G2025, Sigma-Aldrich (Merck), Overijse ...
-
bioRxiv - Immunology 2021Quote: Cytokine and chemokine levels produced by PCLS after 2 dpi were assessed in a Multiplex assay in supernatants (dilution 1:2) with MILLIPLEX® Bovine Cytokine/Chemokine Panel 1 (BCYT1-33K-PX15, Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... tumors were enzymatically digested with 2,000 U/mL of DNase I and 2 mg/mL of collagenase IV (both from Sigma Aldrich, Merck, Israel) in HBSS for 30 min 37 □ ...
-
bioRxiv - Neuroscience 2021Quote: ... the kinetics of ROS production was evaluated for 2 h after the addition of 2,7-dichloro-diidrofluorescineacetate (DCFH-DA, Merck, Darmstadt, Germany) using the Microplate Reader GloMax fluorimeter (Promega Corporation ...
-
bioRxiv - Molecular Biology 2021Quote: ... The fractions corresponding to the elution peak were selected and concentrated to 2-50 mg/mL through the use of Amicon® Ultra-15 Centrifugal Unit (Merck), frozen and stored at −80°C for downstream experiments ...
-
bioRxiv - Biochemistry 2022Quote: ... The eluate of the affinity purification was concentrated to a volume between 1-2 mL before injection using centrifugal filter units (Amicon, Merck millipore) with a MWCO of 5,000 Da ...
-
bioRxiv - Cell Biology 2022Quote: ... femurs and tibias of C57BL/6J mice were extracted and crushed on a mortar in PBS supplemented with 4%FBS and 2 mM EDTA and filtered through 0.45μm strainers (Merck Millipore, Cat#SLHV033RB). For B cells ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were maintained in Opti-MEM™ I Reduced Serum Medium + GlutaMax™ (Thermo Fischer Scientific) supplemented with 2% foetal bovine serum (FBS, Thermo Fischer Scientific) and 1% Anti-Anti 100X (Merck) at 37 °C in a humified atmosphere of 5% CO2 ...
-
bioRxiv - Plant Biology 2023Quote: ... and concentrated to 2 mg chlorophyll mL-1 using a 100-kDa molecular-weight cut-off centrifugal filter unit (Amicon Ultra-15, Merck Millipore). A 3 µl volume of the sample was applied to a glow-discharged holey carbon grid (GIG ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 plugs of C18 octadecyl 47mm Disks 2215 (Empore™) material and 1mg:10 μg of LiChroprep® RP-18 (Merck) ...
-
bioRxiv - Zoology 2023Quote: ... it was fractionated into the different fatty acid classes over an activated silicic acid column (heated at 120ºC for 2 h; Merck Kieselgel 60) via eluting with 7 ml chloroform ...
-
bioRxiv - Immunology 2022Quote: ... Cells were fixed with 2% paraformaldehyde for 10 min at room temperature and stained with the Hemacolor Rapid Staining Kit (Merck Millipore). Images were collected on BX61 upright microscope (Olympus ...
-
bioRxiv - Plant Biology 2024Quote: ... Pto DC3000 ΔavrPto ΔavrPtoB was cultured in NYG-medium (0.5% [w/v] peptone, 0.3% [w/v] yeast extract, 2% [v/v] glycerol; Merck KGaA, Darmstadt, Germany) with appropriate antibiotics (50 µg/ml rifampicin ...
-
bioRxiv - Molecular Biology 2024Quote: Serum-free media from transfected HEK293T was concentrated to about 2 ml with Amicon Ultra-15 Centrifugal Filter 10 kDa MWCO (Merck Millipore) at 3,000 rcf for 15-20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sample volumes of the adhesive tape samples were reduced to 200 µL using Amicon Ultra-2 30K tubes (Merck, section 2.3.9).
-
bioRxiv - Microbiology 2024Quote: ... Transconjugant colonies carrying pCPE16_3blaNDM-1 were selected on LB agar supplemented with 300 µg/mL hygromycin B (PhytoTech Labs, USA) and 2 µg/mL doripenem (Merck, Germany). Conjugation frequencies were calculated using the following formula: Data shown are the mean ± standard deviation of three independent experiments ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Negative control lines ‘NC’ and ‘NC#2’ were generated with U6gRNA-pCMV-Cas9–2A-GFP containing the guide tatgtgcggcaaaccaagcg (CRISPR08; Sigma-Aldrich/Merck). For three days prior to transfection ...
-
bioRxiv - Immunology 2024Quote: Net ALI membrane resistance for each sample was determined by measuring the sample resistance with a MillicellERS-2 Voltohmmeter (Merck Millipore) then subtracting the blank sample resistance reading ...
-
bioRxiv - Neuroscience 2023Quote: ... and the supernatant obtained was spotted 2 μl on the origin point of a reversed-phase plate (RP-18, Merck Millipore) and developed with a mixture solution of acetonitrile ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with a cocktail of 1:100 phosphatase inhibitors cocktail 2 and 3 (Sigma/Merck, P5726-1ML and P0044-1ML, respectively) and 1:100 protease inhibitor cocktail (Sigma/Merck ...