Labshake search
Citations for Merck :
1551 - 1600 of 5475 citations for 7H 1 3 Thiazino 2 3 i purin 5 1H one 2 3 8 9 tetrahydro 2 thioxo since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... About 2 mL of supernatants were then transferred to ultrafiltration tubes (Amicon® Ultra-4 Centrifugal Filter Unit 10K, Merck). 2 mL of TE buffer was added ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were then plated at a density of 500 cells/cm2 into 6-well plates coated with 1.2% poly(2-hydroxyethylmethacrylate) (Merck, Germany) in 95% ethanol (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... Nuclei were recovered by withdrawing a volume of 200 μL from the 30 – 40% interface of the OptiPrep density gradient and transferring to a new 2 mL Sorenson Dolphin microcentrifuge tube (Merck). Nuclei were washed with 2% BSA (in 1x PBS ...
-
bioRxiv - Systems Biology 2024Quote: ... with 100 µl of a 2 % w/v solution of Evans blue tracer in 0.9 % saline (Merck Ltd, Poole, UK) or i.v ...
-
bioRxiv - Neuroscience 2024Quote: ... Tissue sections were reacted overnight at room temperature by immersion in following primary antibodies in blocking solution (2% Donkey Serum (S30-100ML, Merck), BSA (01862-87 ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting concentrated retentate was then filtered through a 0.22 μm filter and added with stabilizing buffer containing 2% (v/v) gelatin hydrolysate (Merck G0262) and 5% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 mM Tris (2-carboxyethyl) phosphine (TCEP)] in presence of equal molar amount of Mu217 DNA in a Pur-A-Lyzer Mini (Merck). Mu217 DNA was purified as previously described7 ...
-
bioRxiv - Bioengineering 2019Quote: ... Samples were post-fixed for 1h in a 1% osmium tetroxide solution in 0.1M sodium cacodylate buffer (Merck) and rinsed three times in the same buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... 9 µM RO-3306 (Merck Millipore) and 10 µM Roscovitine (AdipoGen Life Sciences ...
-
bioRxiv - Cell Biology 2024Quote: ... 9 µM RO-3306 (Merck Millipore) was added to the media 24h after transfection and cells were incubated for 22 h ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-GluR2 (1:2000, AB1768-I, Merck, Darmstadt, Germany) and anti-β-Actin (1:5000 ...
-
bioRxiv - Neuroscience 2023Quote: ... and anti-phospho SMAD2 (1:1000, AB3849-I, MERCK). After rinsing ...
-
bioRxiv - Neuroscience 2021Quote: ... brains were quickly removed from the skull and snap frozen at −25°C in isopentane (2-Methylbutane, Merck Life Science, Italy). Once frozen ...
-
Trypanosoma brucei J protein 2 functionally cooperates with the cytosolic Hsp70.4 and Hsp70 proteinsbioRxiv - Molecular Biology 2019Quote: ... 2 mM MgCl2) or into the appropriate assay buffer for functional studies and then subsequently concentrated against PEG 20000 (Merck, Germany). The protein yield was estimated using the Bradford assay (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2019Quote: ... Pelet was dissolved in 2 ml DDW and passed through a 0.2-μm membrane filter (Millex-GV Filter Unit, Merck Millipore, Ireland). The filtrate was used for sucrose ...
-
bioRxiv - Neuroscience 2020Quote: ... cryoprotected for 48 h in 20% sucrose at 4°C and then snap frozen in isopentane (2-methylbutane, Merck GmbH, Austria) for 3 min at −60°C ...
-
bioRxiv - Neuroscience 2020Quote: ... a buffer suitable to investigate aggregates resistance to digestion (detailed below) and 2) the SysQuant Buffer (8M urea, phosphatase inhibitor (PhosSTOP™, Merck) and protease inhibitor (cOmplete™ ...
-
Dual signaling via interferon and DNA damage response elicits entrapment by giant PML nuclear bodiesbioRxiv - Microbiology 2021Quote: ... PAb directed against phospho-STAT2 (Tyr689) and MAb directed against human IFNα/β receptor chain 2 (MAB1155) were purchased from Merck-Millipore.
-
bioRxiv - Bioengineering 2021Quote: Unbound DNA was removed from DNA-SWCNT samples prepared by direct sonication and MeOH-assisted surfactant exchange by rinsing with Amicon centrifugal ultra-filtration devices (Amicon Ultra-2, Sigma Aldrich, 100 kDa membrane, Merck), as detailed above ...
-
bioRxiv - Bioengineering 2021Quote: ... and GEES protein fractions (2-16 µg) were processed by the MED-FASP protocol using Microcon 30k centrifugal ultrafiltration units (Merck, Darmstadt) [11] ...
-
bioRxiv - Biochemistry 2020Quote: ... Next the medium was replaced with a serum-free media supplemented with 2 nM brain-derived neurotrophic factor (BDNF) (Merck Millipore). After 2 days in the BDNF-containing media ...
-
bioRxiv - Neuroscience 2020Quote: The barrier integrity of the in vitro BBB models was assessed through measurements of TEER using Millicell ERS-2 epithelial volt-ohm Meter and STX01 Chopstick Electrodes (Merck Millipore). The TEER value for each hanging culture insert was obtained from an average of three individual measurements subtracted the TEER value of a double-coated cell-free hanging culture insert and multiplied by the area of the hanging culture insert (1.12cm2) ...
-
bioRxiv - Plant Biology 2022Quote: CGMMV vsiRNAs were quantified by RT-qPCR according to Shi and Chiang (2005) with some modifications: 2 μg of RNA extracts from the cucumber leaves were treated with DNaseI (Merck, Spain) and polyadenylated using the Poly(A ...
-
bioRxiv - Immunology 2020Quote: PBMCs were rested overnight in complete medium and seeded at 2 × 105 cells/well in MultiScreen HTS Filter Plates (Merck Millipore) pre-coated with anti-IFN-γ (clone 1-D1K ...
-
bioRxiv - Biophysics 2022Quote: The dyes used in this study and the working dilutions were: 6-Dodecanoyl-N,N-dimethyl-2-naphthylamine (LAURDAN, 4.5 μM, Sigma-Aldrich, Merck, #40227), Hoechst 33342 (80 uM ...
-
bioRxiv - Plant Biology 2020Quote: ... tumefaciens were resuspended in 50 mM MES (2-Morpholinoethanesulfonic acid hydrate) (Duchefa, Haarlem, The Netherlands) - KOH buffer (pH 5.6) containing 2mM NaH2PO4 (Merck, Darmstadt, Germany), 100 µM acetosyringone (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... used for barrier dysfunction experiments were conducted on a 37 °C heating block using a Millicell ERS-2 Voltohmmeter (Merck-Millipore) equipped with an Ag/AgCl electrode (STX01) ...
-
bioRxiv - Molecular Biology 2021Quote: TEER measurements [22] were performed on 3rd day of incubation with growth factors and (or) different inhibitors by using Millicell ERS-2 Electrical Resistance System (Merck-Millipore). Each insert was measured in three different locations ...
-
bioRxiv - Molecular Biology 2020Quote: ... we repeated the experimental protocol and behavioral battery in wild type zebrafish larvae using 2 μM THC (Merck, Cat. No. T4764), and 0.15 μM nicotine (Sigma ...
-
bioRxiv - Biochemistry 2019Quote: ... Fractions containing the desired His6-tagged protein were concentrated to 2 ml using Amicon® Ultra Centrifugal Filters (10,000 MWCO, Merck Millipore), and were directly injected into a size-exclusion chromatography column (Superdex 75 16/60 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and 2 μl of the enzyme β-glucuronidase (from Helix from Pomatia enzyme aqueous solution, ≥ 100.000 units/mL; Merck, Darmstadt, Germany) to deconjugate DEHP metabolites and BPA ...
-
bioRxiv - Neuroscience 2021Quote: ... the kinetics of ROS production was evaluated for 2 h after the addition of 2,7-dichloro-diidrofluorescineacetate (DCFH-DA, Merck, Darmstadt, Germany) using the Microplate Reader GloMax fluorimeter (Promega Corporation ...
-
bioRxiv - Molecular Biology 2021Quote: ... The fractions corresponding to the elution peak were selected and concentrated to 2-50 mg/mL through the use of Amicon® Ultra-15 Centrifugal Unit (Merck), frozen and stored at −80°C for downstream experiments ...
-
bioRxiv - Cell Biology 2022Quote: ... femurs and tibias of C57BL/6J mice were extracted and crushed on a mortar in PBS supplemented with 4%FBS and 2 mM EDTA and filtered through 0.45μm strainers (Merck Millipore, Cat#SLHV033RB). For B cells ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 plugs of C18 octadecyl 47mm Disks 2215 (Empore™) material and 1mg:10 μg of LiChroprep® RP-18 (Merck) ...
-
bioRxiv - Zoology 2023Quote: ... it was fractionated into the different fatty acid classes over an activated silicic acid column (heated at 120ºC for 2 h; Merck Kieselgel 60) via eluting with 7 ml chloroform ...
-
bioRxiv - Immunology 2022Quote: ... Cells were fixed with 2% paraformaldehyde for 10 min at room temperature and stained with the Hemacolor Rapid Staining Kit (Merck Millipore). Images were collected on BX61 upright microscope (Olympus ...
-
bioRxiv - Microbiology 2024Quote: ... Transconjugant colonies carrying pCPE16_3blaNDM-1 were selected on LB agar supplemented with 300 µg/mL hygromycin B (PhytoTech Labs, USA) and 2 µg/mL doripenem (Merck, Germany). Conjugation frequencies were calculated using the following formula: Data shown are the mean ± standard deviation of three independent experiments ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sample volumes of the adhesive tape samples were reduced to 200 µL using Amicon Ultra-2 30K tubes (Merck, section 2.3.9).
-
bioRxiv - Molecular Biology 2024Quote: Serum-free media from transfected HEK293T was concentrated to about 2 ml with Amicon Ultra-15 Centrifugal Filter 10 kDa MWCO (Merck Millipore) at 3,000 rcf for 15-20 min ...
-
bioRxiv - Immunology 2024Quote: Net ALI membrane resistance for each sample was determined by measuring the sample resistance with a MillicellERS-2 Voltohmmeter (Merck Millipore) then subtracting the blank sample resistance reading ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Negative control lines ‘NC’ and ‘NC#2’ were generated with U6gRNA-pCMV-Cas9–2A-GFP containing the guide tatgtgcggcaaaccaagcg (CRISPR08; Sigma-Aldrich/Merck). For three days prior to transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... produced by the mix of 50 ml of sodium hypochlorite 10% (Roth, ref. 9062.3) and 2 ml of 37% hydrochloric acid (Merck, ref. 1.00317.1000). Seeds were then aerated for 10 min in a sterile bench to remove the left-over chlorine gas ...
-
bioRxiv - Plant Biology 2023Quote: ... from 25 plants were transferred into a Teflon vessel and digested with 2 mL of 65% HNO3 and 0.5 mL H2O2 (Suprapur; Merck, Darmstadt, Germany) in a MarsXpress microwave digestion system (CEM ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell nuclei were stained with DAPI (4 ’,6-diamidino-2-fenilindol) and slides were mounted using FluorSave™ Reagent (Merck Millipore). The sections were observed and visualized on a Leica DM2500 fluorescent microscope (Leica Microsystems) ...
-
bioRxiv - Microbiology 2023Quote: ... 10 pylorus and ileum sections from bees coming from the same cage were pooled in a 2 ml screw cap tube containing 750 μl of TRI reagent (Sigma-Aldrich, Merck), glass beads (0.75-1 mm diameter ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... followed by washing with 1XPBS two times for 2’ each and blocked again with Biotin (0.001%, Sigma-Aldrich, Merck, Overijse, Belgium) for 20’ and washed twice for 2’ in 1XPBS each ...
-
bioRxiv - Neuroscience 2023Quote: ... and the supernatant obtained was spotted 2 μl on the origin point of a reversed-phase plate (RP-18, Merck Millipore) and developed with a mixture solution of acetonitrile ...
-
bioRxiv - Plant Biology 2024Quote: ... Pto DC3000 ΔavrPto ΔavrPtoB was cultured in NYG-medium (0.5% [w/v] peptone, 0.3% [w/v] yeast extract, 2% [v/v] glycerol; Merck KGaA, Darmstadt, Germany) with appropriate antibiotics (50 µg/ml rifampicin ...
-
bioRxiv - Neuroscience 2024Quote: ... the elution of the biotinylated proteins was carried out boiling the beads in 25 μl of 3X protein loading buffer supplemented with 20 mM DTT and 2 mM Biotin (Merck, B4501) for 10 min at 95°C in gentle shaking ...