Labshake search
Citations for Merck :
1501 - 1550 of 2064 citations for 5 M TOLYL FURAN 2 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... at 1/1000 dilution or Laurdan (#40227, 6-Dodecanoyl-N,N-dimethyl-2-naphthylamine, Merck, Sigma-Aldrich) at 1/500 dilution for 30 min at 37°C in the dark ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 mM EE-analog in 150 µL of CH3OH were incubated with 2 mg/mL NaBH4 (Merck) in 150 µL of CH3OH at 37 °C for 1 h ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 0.43 mM MgCl2) with the addition of 0.2 mM 1-phenyl-2-thiourea (PTU, Merck, Germany) to block pigmentation ...
-
bioRxiv - Developmental Biology 2023Quote: ... gastruloids were incubated with secondary antibodies and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4°C overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 ml EDTA tubes were prepared with 100μl protease inhibitor (Pefabloc® SC Plus, Merck KGaA, Germany) before blood collection ...
-
bioRxiv - Neuroscience 2023Quote: Trypsinise Ara-C purified SCs using 1 ml of 6% 2 mg ml-1 Trypsin (Merck - 85450C) in Versene (0.02% EDTA (Thermo Fisher - D/0700/53 ...
-
bioRxiv - Microbiology 2023Quote: ... The lysate was then incubated with 2 mL pre-washed HIS-Select Cobalt Affinity Gel (Merck, UK) with rotation for an hour ...
-
bioRxiv - Cell Biology 2023Quote: ... and fertilized eggs were cultured in EmbryoMax KSOM Medium (1X) w/ 1/2 Amino Acids (Merck Millipore) at 37°C and 5% CO2 ...
-
bioRxiv - Plant Biology 2024Quote: ... patens grown on PpNH4 were homogenized in 2 mL tubes using 3-mm zirconium glass beads (Merck) in presence of 500 µL of cold TEN buffer (Tris-HCl 100 mM ...
-
bioRxiv - Neuroscience 2024Quote: ... The homogenate was moved to 2 ml tubes and then 40% polysucrose 400 (P7798-100 g, Merck) in DPBS with calcium and magnesium was added in equal volumes for a final concentration of 20% ...
-
bioRxiv - Cell Biology 2020Quote: Epithelial canine MDCK II (CRL2936) cells were obtained from the ATCC and grown in MEM supplemented with 5% FBS (Merck) at 37°C in an atmosphere of 5% CO2 ...
-
bioRxiv - Microbiology 2021Quote: ... PBMCs (2 × 106 cells) were plated onto 48-well plates (NalgeNunc) in RPMI-1640 with 5% inactivated male human AB serum (Merck) for 3 hours ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated with FITC (Fluorescein isothiocyanate) conjugated secondary antibody (0.5 μg/ml of Goat Anti-Mouse IgG-FITC in 5%BSA) (GeNei, Merck, USA) (Cat.no ...
-
bioRxiv - Developmental Biology 2021Quote: ... they were washed again in PBS (three times, each for 5 min) and mounted with antifade solution (Cat.no. S7114, Sigmsa-Aldrich, Merck, USA). Images were acquired using a Leica DM 2500 fluorescent microscope (Leica ...
-
bioRxiv - Molecular Biology 2019Quote: RNA for each biological repeat was extracted from 110 mg of rosette leaves number 5-6 (from at least six plants) with TRI Reagent (Merck) and rounds of phenol-chloroform and chloroform extractions followed by isopropanol precipitation ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Developmental Biology 2022Quote: ... slides were incubated with a solution containing 1/50 phalloidin alexa fluor 488 in PBST supplemented with 5% DMSO (Merck) and covered with parafilm (Bemis ...
-
bioRxiv - Microbiology 2020Quote: ... 5×106 cells from treated and untreated conditions were centrifuged for 5 min at 4,500 g and the pellets were resuspended in 4% paraformaldehyde (PFA, Merck, Germany), and incubated for 20 min ...
-
bioRxiv - Microbiology 2019Quote: ... and bacterial pellets were resuspended in 5 ml of cold column buffer with 1x PIC (Protease inhibitor cocktail set I; Cat. Nr. 539131-10VL, Merck) and 200 mM PMSF (Cat ...
-
bioRxiv - Bioengineering 2019Quote: Fixed samples were centrifuged at 1,957 x g for 5 min at room temperature and re-suspended in cold Milli-Q water (Merck-Millipore) (4°C) ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Cell Biology 2021Quote: ... HL-60 and MS-5 cells cultured alone and in co-culture were incubated for 24 hours in 50 μM H2O2 (Merck) complete cell culture medium ...
-
bioRxiv - Neuroscience 2020Quote: ... two custom-made Teflon containers of 5 mm diameter were filled with 10 μl of odor substance (n-amylacetate, AM; CAS: 628-63-7, Merck, Darmstadt ...
-
bioRxiv - Microbiology 2021Quote: ... Identification of metabolites for LC-MS was performed with a ZIC pHILIC column (150 mm × 4.6 mm, 5 μm column, Merck Sequant) coupled to high-resolution Thermo Orbitrap QExactive (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... chromatographic separation was performed on ZIC-pHILIC column equipped with a guard (5 µm, 4.6 × 150 mm, SeQuant®, Merck). The mobile phase (A ...
-
bioRxiv - Biophysics 2020Quote: ... 50 μL of sample was injected onto a Discovery BIO Wide Pore C18 column (15 cm x 4.6 mm, 5 μm column with a guard column) (Supelco, Merck, UK) and eluted on a gradient of 95% water + 0.1% acetic acid and 5% acetonitrile + 0.1% acetic acid to 5% water + 0.1% acetic acid and 95% acetonitrile + 0.1% acetic acid at a 0.8 mL/min flow-rate over 40 mins ...
-
miR-206 inhibits estrogen-induced proliferation and invasion of ER-α36 positive gastric cancer cellsbioRxiv - Cancer Biology 2021Quote: ... 20 μL of the MTT solution was added to each well (5 mg/ml, Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). Then ...
-
bioRxiv - Cell Biology 2021Quote: ... against a final buffer (20mM Hepes, 200 mM NaCl, 5% Glicerol, 2mM DTT) and concentrated with appropriate MW cut-off Vivaspin columns (Merck). The concentration of purified proteins was determined by colorimetric assay (Bio-Rad DC Protein Assay ...
-
bioRxiv - Cell Biology 2021Quote: ... Spleen cells isolated from the mouse with the best serum titre were fused with Sp2/0 cells in the ratio of 5:1 using polyethylene glycol (PEG) 3000 (#817019, Merck). 10 million cells of the fusion mix were combined with 2x 104 BALB/c peritoneal macrophages and seeded in a 96-well plate ...
-
bioRxiv - Cell Biology 2021Quote: The samples were loaded onto a 5–20% gradient SDS-PAGE gel (Wako, Osaka, Japan) and transferred to an Immobilon-P Transfer Membrane (Merck). Antibodies were diluted with Signal Enhancer HIKARI for Western Blotting and ELISA (Nacalai Tesque) ...
-
bioRxiv - Microbiology 2022Quote: ... Separation in the HPLC was carried out using a SeQuant ZIC-pHILIC column (PEEK 150 × 2,1 mm, 5 μm, 110 Å, Merck) at 30 °C with an CH3CN (buffer A ...
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: HEK293T cells were cultured in 10 cm tissue culture treated dishes grown at 37 °C in a 5% CO2 atmosphere in HEPES buffered DMEM/F12 1:1 (Merck) supplemented with 10% fetal bovine serum and 2 mM L-glutamine ...
-
bioRxiv - Microbiology 2021Quote: ... For detection of particle incorporation virus supernatant was further concentrated by centrifugation at 4°C for 2h at 21000xg on 5% Optiprep (Merck), the supernatant was removed and pellet was resuspended and subjected to Western Blot analysis ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were incubated for 72h with the indicated concentrations of the respective drugs and further incubated for 3h with 5 mg/ml MTT (Merck). Finally ...
-
bioRxiv - Pathology 2019Quote: ... For MALDI-TOF/TOF/MS analysis dried peptides were dissolved in peptide resuspension solution (0.1% TFA in 5% ACN) and desalted/concentrated using C18 zip tips (Merck Millipore) as per the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... Nuclei were pelleted by centrifugation at 3000 rpm for 5 min at 4°C and were resuspended in hypotonic buffer containing 1U/µl of benzonase (Merck). Extracts were incubated on ice for 30 min ...
-
bioRxiv - Microbiology 2019Quote: ... Chromatographic separation was achieved using a silica-based SeQuant ZIC-pHILIC column (2.1 mm × 150 mm, 5 µm, Merck, Germany) with elution buffers consisting of (A ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Membranes were blocked using 5% non-fat dry milk in Tris-buffered saline with 0.1% Tween 20 (655204, Merck Millipore) and probed with the respective primary and secondary antibodies ...
-
bioRxiv - Developmental Biology 2020Quote: ... pregnant mice were injected intraperitoneally with 375 μg doxycycline (75 μl of a filter sterilized, 5 mg/ml solution of Doxycycline Hyclate (Merck) dissolved in PBS) ...
-
bioRxiv - Microbiology 2021Quote: ... The separation in the HPLC was carried out using a SeQuant ZIC-pHILIC column (PEEK 150 × 2.1 mm, 5 μm, 110 Å, Merck) at 30°C with an CH3CN (buffer A ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were stored at 4°C overnight before desilicification with 4% suprapure hydrofluoric acid (Merck; incubation of approximately 5 hours). Afterwards ...
-
bioRxiv - Microbiology 2021Quote: ... The sonicated cellular extract was spun down and the supernatant has been incubated with His-binding resin (Merck 69670-5) for 10-30 min at room temperature ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... supernatants containing RBD or soluble Spike were concentrated and diafiltrated against 20 mM sodium phosphate buffer containing 500 mM NaCl and 20 mM imidazole (pH 7.4) using a Labscale TFF system equipped with a 5 kDa cut-off Pellicon XL device (Merck Millipore). The His-tagged proteins were captured using a 5 mL HisTrap FF crude column connected to an ÄKTA pure chromatography system (both from Cytiva ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the plates were incubated at 33 °C in a 5% CO2 atmosphere in fresh medium with 0.25% Hoechst (Merck-Millipore) to stain the DNA ...
-
bioRxiv - Microbiology 2019Quote: ... samples were fixed in 2.5% (v/v) glutaraldehyde in HBSS on IsoporeTM membrane TMTP filters with pore size 5 µm (Merck-Millipore) for 30 min followed by washing thrice with HBSS buffer (10 min each) ...
-
bioRxiv - Cell Biology 2021Quote: ... LECs (1.5 × 105) were transfected with 25 pmol of target siRNA or non-target siRNA (MISSION siRNA universal control#1, Merck) using Lipofectamine RNAiMAX (Thermo Fisher ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 mM MgCl2 buffer at a final concentration of 5 mg/mL using three consecutive cycles of freezing in liquid nitrogen and thawing in an ultrasonic bath (Merck). The rehydrated lipid solutions were extruded 21 times through a 100 nm diameter pore size polycarbonate membrane (Avanti Polar Lipids Inc.) ...
-
bioRxiv - Biochemistry 2022Quote: ... The resulting cell pellet was freeze-thawed thrice and re-suspended to 10% (w/v) in a lysis buffer containing 5% (v/v) Polysorbate 80 and 20 U/mL benzonase (Merck). After 1h incubation at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... the sections were treated with 10% methanol in PB for 20 min and then incubated for 1 h at RT in incubation buffer: 5% normal donkey serum (NDS: Merck) and 0.2% Triton X-100 (Merck ...