Labshake search
Citations for Merck :
1201 - 1250 of 2552 citations for 3RS 4 Dimethylamino 3 methyl 2 2 diphenylbutanenitrile Isodidiavalo since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: The crude ethylacetate extract of ALR-2 was purified via column chromatography using a LiChroprep RP-18 (15-25 μm) silica gel column (Merck, EMD Millipore Corporation, USA) and chloroform:methanol (ratio 4:1 ...
-
bioRxiv - Biochemistry 2021Quote: ... modifying on previous reported conditions for the assay of MjRibK.[2] The reaction mixture was incubated at 37°C overnight and visualized using fluoresce-based thin layer chromatography (TLC) (Merck Silica gel 60 F254) using the long wavelength (365 nm ...
-
bioRxiv - Microbiology 2022Quote: ... we used the same approaches as described above and spotted the 5 μl of bacteria on LB agar plates containing 2% of Skim Milk Powder for microbiology (Sigma-Aldrich/Merck KGaA, Darmstadt, Germany). Plates were incubated at 25°C and monitored for hemolytic and protease activities after 1 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Peak fractions containing the desired protein were pooled and concentrated to 2 ml in Amicon Ultra-15 concentrators 3,000 molecular weight cut-off (Merck Millipore, Carrigtwohill Co. Cork IRL). Concentrated protein was loaded onto a HiLoad 26/60 Superdex 75 prep grade column (GE Healthcare ...
-
bioRxiv - Microbiology 2020Quote: ... 48 and 72 hours) of exposure to simulated solar radiation was performed by using 2’,7’-Dichlorodihydrofluorescein diacetate (DCFH-DA) (Sigma Aldrich-Merck KGaA, Darmstadtm Germany) solubilized in ethanol ...
-
bioRxiv - Genomics 2024Quote: ... The samples were digested in a closed-vessel microwave system (MarsExpress; CEM Corp; Matthews, NC, USA) in 2 ml of 30% (v/v) premium-grade H2O2 (Merck, EMSURE®, Darmstadt, Germany) and 5 ml of 65% (v/v ...
-
bioRxiv - Developmental Biology 2024Quote: ... and cultured as described in 39 using the following procedure: Cord blood samples were diluted 1:2 in PBS and layered on Ficoll® Paque Plus (Sigma-Aldrich by Merck, Darmstadt, Germany) to isolate mononuclear cells ...
-
bioRxiv - Immunology 2022Quote: Murine lungs were perfused and fixed overnight at 4 °C in 4% paraformaldehyde (Merck Millipore) under agitation ...
-
bioRxiv - Developmental Biology 2023Quote: ... slides were incubated for 4 h at 4°C with DAPI (1 µg/mL, Merck) and the following secondary antibodies diluted in blocking buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... and 3 μL (equivalent to 3 mg cell dry weight) were spotted on HPTLC silica gel 60 plates (Merck) and developed in chloroform/methanol/13 M NH3/1 M NH4Ac/water (180:140:9:9:23 ...
-
bioRxiv - Genomics 2020Quote: ... Teratomas that developed within 4 weeks post-injection were harvested and fixed in 4% paraformaldehyde (Merck), embedded in paraffin ...
-
bioRxiv - Plant Biology 2024Quote: ... samples were acidified to pH 2 with formic acid and desalted with pipette tips packed with six layers of C18 Empore™ SPE Disks (Merck, cat. no.66883-U) and dried in a Speed Vac at 45 °C for 1 hour ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed using 4% paraformaldehyde (Merck, 1040051000) in PBS and permeabilized by CSK buffer (25 mM HEPES pH 7.8 ...
-
bioRxiv - Genetics 2021Quote: ... fixed with 4% paraformaldehyde (PFA, Merck) in PBS (pH = 7.5) ...
-
bioRxiv - Cell Biology 2020Quote: ... and fixed in 4% paraformaldehyde (Merck) overnight at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... 4-amino pyridine (5 mM, Merck) and TTX (0.5-1 μM ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4 μg/ml heparin (Sigma/Merck), 20 ng/ml EGF (Peprotech) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 4 g/l thiamine-HCl (Merck), and 40 g/l myo-inositol (Merck) ...
-
bioRxiv - Genomics 2020Quote: ... and Tubulin beta 4 (#T7941, Merck). To do so ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 mM glutamine (Merck KGA, Germany), 1 mM sodium pyruvate (Merck KGA ...
-
bioRxiv - Bioengineering 2023Quote: ... 4 μg/mL PI (Merck, Germany) and 12 μg/mL Hoechst 33342 (Miltenyi Biotec ...
-
bioRxiv - Microbiology 2024Quote: ... were fixed with 4% formaldehyde (Merck) diluted in PBS 1X for 10 min at room temperature and then washed 3 times with PBS 1X ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by 4 % PFA (1004005, Merck) (w/v ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-Hydroxytamoxifen (4OHT) (Merck Sigma-Aldrich) was added at a final concentration 100 nM for 10-12 hours to induce the recombination of the Lynflallele.
-
bioRxiv - Bioengineering 2023Quote: ... MOWIOL 4-88 Reagent (475904, Merck); LysoTracker Deep Red (L12492 ...
-
bioRxiv - Bioengineering 2024Quote: ... MOWIOL 4-88 reagent (475904, Merck); High Pure RNA Isolation Kit (11828665001 ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of Benzonase (Merck Millipore, US170664-3) was added and samples left on ice until an aqueous solution formed (30 min to 1 h) ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (BSA, Merck/Sigma-Aldrich) in PBS was added as blocking buffer and incubated for 1 hour ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...
-
bioRxiv - Plant Biology 2024Quote: ... protoplasts were treated with 3 µM DAPI (Merck) overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3-NT (1:1000, 06-284, Merck) were used ...
-
bioRxiv - Neuroscience 2024Quote: ... or 3-NT (1:1000; 06-284, Merck). Following primary antibody incubation ...
-
bioRxiv - Microbiology 2024Quote: ... 3 rounds of phenol-chloroform-isoamyl alcohol (Merck) extraction were performed using 15 ml gel-lock tubes (QIAGEN) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.