Labshake search
Citations for Merck :
1051 - 1100 of 2552 citations for 3RS 4 Dimethylamino 3 methyl 2 2 diphenylbutanenitrile Isodidiavalo since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... and the other stored at −80 °C in a sterile 2 ml cryovial containing 1 ml of a 30 % glycerol solution, prepared by diluting glycerol (≥99 %, G2025, Sigma-Aldrich (Merck), Overijse ...
-
bioRxiv - Immunology 2021Quote: Cytokine and chemokine levels produced by PCLS after 2 dpi were assessed in a Multiplex assay in supernatants (dilution 1:2) with MILLIPLEX® Bovine Cytokine/Chemokine Panel 1 (BCYT1-33K-PX15, Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... tumors were enzymatically digested with 2,000 U/mL of DNase I and 2 mg/mL of collagenase IV (both from Sigma Aldrich, Merck, Israel) in HBSS for 30 min 37 □ ...
-
bioRxiv - Neuroscience 2021Quote: ... the kinetics of ROS production was evaluated for 2 h after the addition of 2,7-dichloro-diidrofluorescineacetate (DCFH-DA, Merck, Darmstadt, Germany) using the Microplate Reader GloMax fluorimeter (Promega Corporation ...
-
bioRxiv - Molecular Biology 2021Quote: ... The fractions corresponding to the elution peak were selected and concentrated to 2-50 mg/mL through the use of Amicon® Ultra-15 Centrifugal Unit (Merck), frozen and stored at −80°C for downstream experiments ...
-
bioRxiv - Biochemistry 2022Quote: ... The eluate of the affinity purification was concentrated to a volume between 1-2 mL before injection using centrifugal filter units (Amicon, Merck millipore) with a MWCO of 5,000 Da ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were maintained in Opti-MEM™ I Reduced Serum Medium + GlutaMax™ (Thermo Fischer Scientific) supplemented with 2% foetal bovine serum (FBS, Thermo Fischer Scientific) and 1% Anti-Anti 100X (Merck) at 37 °C in a humified atmosphere of 5% CO2 ...
-
bioRxiv - Plant Biology 2023Quote: ... and concentrated to 2 mg chlorophyll mL-1 using a 100-kDa molecular-weight cut-off centrifugal filter unit (Amicon Ultra-15, Merck Millipore). A 3 µl volume of the sample was applied to a glow-discharged holey carbon grid (GIG ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 plugs of C18 octadecyl 47mm Disks 2215 (Empore™) material and 1mg:10 μg of LiChroprep® RP-18 (Merck) ...
-
bioRxiv - Zoology 2023Quote: ... it was fractionated into the different fatty acid classes over an activated silicic acid column (heated at 120ºC for 2 h; Merck Kieselgel 60) via eluting with 7 ml chloroform ...
-
bioRxiv - Immunology 2022Quote: ... Cells were fixed with 2% paraformaldehyde for 10 min at room temperature and stained with the Hemacolor Rapid Staining Kit (Merck Millipore). Images were collected on BX61 upright microscope (Olympus ...
-
bioRxiv - Plant Biology 2024Quote: ... Pto DC3000 ΔavrPto ΔavrPtoB was cultured in NYG-medium (0.5% [w/v] peptone, 0.3% [w/v] yeast extract, 2% [v/v] glycerol; Merck KGaA, Darmstadt, Germany) with appropriate antibiotics (50 µg/ml rifampicin ...
-
bioRxiv - Molecular Biology 2024Quote: Serum-free media from transfected HEK293T was concentrated to about 2 ml with Amicon Ultra-15 Centrifugal Filter 10 kDa MWCO (Merck Millipore) at 3,000 rcf for 15-20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sample volumes of the adhesive tape samples were reduced to 200 µL using Amicon Ultra-2 30K tubes (Merck, section 2.3.9).
-
bioRxiv - Microbiology 2024Quote: ... Transconjugant colonies carrying pCPE16_3blaNDM-1 were selected on LB agar supplemented with 300 µg/mL hygromycin B (PhytoTech Labs, USA) and 2 µg/mL doripenem (Merck, Germany). Conjugation frequencies were calculated using the following formula: Data shown are the mean ± standard deviation of three independent experiments ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Negative control lines ‘NC’ and ‘NC#2’ were generated with U6gRNA-pCMV-Cas9–2A-GFP containing the guide tatgtgcggcaaaccaagcg (CRISPR08; Sigma-Aldrich/Merck). For three days prior to transfection ...
-
bioRxiv - Immunology 2024Quote: Net ALI membrane resistance for each sample was determined by measuring the sample resistance with a MillicellERS-2 Voltohmmeter (Merck Millipore) then subtracting the blank sample resistance reading ...
-
bioRxiv - Neuroscience 2023Quote: ... and the supernatant obtained was spotted 2 μl on the origin point of a reversed-phase plate (RP-18, Merck Millipore) and developed with a mixture solution of acetonitrile ...
-
bioRxiv - Molecular Biology 2024Quote: ... The nuclei pellet was washed once in 5 mL of Honda buffer then purified on a Percoll density gradient as follows: 2 mL of 75% Percoll (Merck, P7828) in Honda buffer topped with 2 mL of 40% Percoll in Honda buffer topped with the nuclei pellet resuspended in Honda buffer in a 15 mL tube ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfectants with stably integrated GOI were then selected based on their resistance to G418 (0.5 mg/ml, 1-2 weeks, Merck, Cat.N. G8168). To induce the expression of the GOI the cells were treated with doxycycline (2 μg/ml ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The routinely used growth medium was composed of yeast extract (1%(w/v)) (Fisher BioReagents™) and casein peptone (2%(w/v)) (Merck), and was supplemented with 2% (w/v ...
-
bioRxiv - Cell Biology 2023Quote: ... produced by the mix of 50 ml of sodium hypochlorite 10% (Roth, ref. 9062.3) and 2 ml of 37% hydrochloric acid (Merck, ref. 1.00317.1000). Seeds were then aerated for 10 min in a sterile bench to remove the left-over chlorine gas ...
-
bioRxiv - Plant Biology 2023Quote: ... from 25 plants were transferred into a Teflon vessel and digested with 2 mL of 65% HNO3 and 0.5 mL H2O2 (Suprapur; Merck, Darmstadt, Germany) in a MarsXpress microwave digestion system (CEM ...
-
bioRxiv - Microbiology 2023Quote: ... 10 pylorus and ileum sections from bees coming from the same cage were pooled in a 2 ml screw cap tube containing 750 μl of TRI reagent (Sigma-Aldrich, Merck), glass beads (0.75-1 mm diameter ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were transfected with 1-2 µg of pcDNA5 FRT/TO plasmids containing the gene of interest using GeneJuice transfection reagent (Cat#70967, Merck Millipore) according to manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: Cells were homogenized in 20 mM Tris-HCl buffer (pH 7.2, 0.2 mM EGTA, 5 mM β-mercaptoethanol, 2% (v/v) antiprotease cocktail (Merck KGaA, Germany), 1 mM PMSF ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... followed by washing with 1XPBS two times for 2’ each and blocked again with Biotin (0.001%, Sigma-Aldrich, Merck, Overijse, Belgium) for 20’ and washed twice for 2’ in 1XPBS each ...
-
bioRxiv - Plant Biology 2023Quote: Plants were grown on 1/2 MS agar plates containing 0.01% (v/v) dimethyl sulfoxide (mock) or 50 ng mL-1 TM (654380; Merck, Darmstadt, Germany) for 14 days ...
-
bioRxiv - Paleontology 2023Quote: All aqueous solutions were prepared from ultrapure grade water obtained by water filtration with a two stages Millipore system (Milli-Q® Academic with a cartouches Q-Gard 1 and Progard 2, Merck Millipore ...
-
bioRxiv - Neuroscience 2024Quote: ... the elution of the biotinylated proteins was carried out boiling the beads in 25 μl of 3X protein loading buffer supplemented with 20 mM DTT and 2 mM Biotin (Merck, B4501) for 10 min at 95°C in gentle shaking ...
-
bioRxiv - Microbiology 2024Quote: ... ParT (S48C)-His6 and ParT (Q271C)-His6 aliquots were supplemented with 1 mM tris (2-carboxyethyl) phosphine hydrochloride (Merck; cat# C4706) before flash-freezing in liquid nitrogen.
-
bioRxiv - Microbiology 2024Quote: ... (Loba Chemie, India), nickel (Nickel Chloride Hexahydrate, NiCl2.6H2O) (Loba Chemie, India), and lead (Lead Nitrate, Pb(NO3)2) (Merck Chemicals, India) at a concentration of 100µg/mL ...
-
bioRxiv - Immunology 2024Quote: ... and EV- containing fractions were pooled and concentrated to 2 ml with 10 kDa molecular weight cut-off Amicon centrifugal filter units (Merck Millipore). For the proteomic analysis ...
-
bioRxiv - Microbiology 2024Quote: ... 4 mM MgCl2 (optimal ATP to MgCl2 ratio), 0.2 mM NADH, 2 mM PEP, 8 U PK (rabbit muscle, (Merck, Darmstadt, Germany)) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and then the salts of PBS were removed using the Amicon Ultra-2 centrifugal filter units from Merck (New Jersey, USA). The sample was added on a formvar-coated carbon grid ...
-
bioRxiv - Biochemistry 2024Quote: ... 18 µL of a 20 µM solution of LmPDTN56C was mixed with 2 µL 100x SYPRO Orange (Merck kGaA, Darmstadt, Germany). The samples were then subjected to a temperature ramp spanning from 35 to 95 °C at 1 °C/min recording the fluorescent emission (Exc ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell culture media was changed to FCS-free high glucose DMEM containing 12.5 µM 13C16-labelled or unlabelled palmitate conjugated to 2% fatty acid-free bovine serum albumin (BSA, Merck Life Sciences). Palmitate was prepared in cell culture media from 100 mM ethanolic stocks of palmitic acid and conjugated to fatty acid-free BSA by incubating at 55°C in media for 2 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 million cells per mL were suspended in 1 mL of a 1.2% sodium alginate solution (Merck, Saint-Quentin-Fallavier, France). Beads were formed by dripping the cell suspension into a sterile 100 mM CaCl₂ solution (VWR ...
-
bioRxiv - Biochemistry 2024Quote: ... Fractions were analyzed by SDS-PAGE and those containing h15-LOX-2 were pooled and concentrated with an Amicon Ultra Centrifugal Filter (30 kDa cutoff) (Merck, Germany). Finally ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were picked from a single colony and grown overnight in -Ura synthetic minimal media (2 g/L Yeast Synthetic Drop-out Medium Supplement without uracil (Merck #1501), 67 g/L Yeast Nitrogen Base Without Amino Acids (Merck #Y0626) ...
-
bioRxiv - Developmental Biology 2024Quote: ... For each IVF session one epididymis from 12-week-old WT and one from Trim66-null were transferred into 90 μL of capacitation medium, consisting of TYH (Takeo & Nakagata, 2011) with 0.75 mM methyl-β-cyclodextrin (MBCD, Sigma-Aldrich, Merck KGaA, Darmstadt, Germany). Spermatozoa were allowed to disperse from the tissue and incubated for 30 min in a 5% CO2 incubator at 37°C.
-
bioRxiv - Developmental Biology 2022Quote: ... IWP2 (4 µM; Merck), XAV-939 (10 µM ...
-
bioRxiv - Cell Biology 2021Quote: ... 4% sucrose (Merck, S0389) in D-PBS for 15 min and permeabilized with 0.05% saponin (Merck ...
-
bioRxiv - Neuroscience 2021Quote: ... 4 µM aphidicolin (Merck) was used to reduce proliferation and viability of small numbers of non-neuronal cells (Loreto and Gilley ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4% PFA-fixed (Merck) and paraffin-embedded tissues were cut into 15 μm sections (IHC ...
-
bioRxiv - Cell Biology 2022Quote: ... 4 g PFA (Merck) was dissolved in 80 ml PBS heated to 60 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Germany)/ 4% paraformaldehyde (Merck, Germany) in 0.05 M cacodylate buffer pH 7.4) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-OHT (Merck, #H6278) was dissolved in ethanol at 1 mM and used at a final concentration of 0.5 μM in the culturing medium.
-
bioRxiv - Developmental Biology 2024Quote: ... Benzonase (Merck, 70746-4)-treated biotinylated protein samples suspended in 1 mL RIPA buffer were incubated overnight at 4 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... PTP1B KO Ramos were transfected with a doxycycline inducible tet-on vector and exposed to 2 μg/ml doxycycline (Calbiochem, Merck, Darmstadt, Germany) 24 to 48 h before the experiment ...