Labshake search
Citations for Merck :
1151 - 1200 of 4636 citations for 1 6 Chloropyridazin 3 yl piperidine 4 carboxamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Plant Biology 2024Quote: ... patens grown on PpNH4 were homogenized in 2 mL tubes using 3-mm zirconium glass beads (Merck) in presence of 500 µL of cold TEN buffer (Tris-HCl 100 mM ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were later exposed to a 3% bovine serum albumin (BSA, A3912, Merck Life Science, Milan, Italy) solution in DPBS containing 0,1% Triton at room temperature for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... The eluate from each column was pooled and concentrated in a 3 KD amicon column (Merck, UFC5003) to just under 100 μl ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Cancer Biology 2024Quote: ... the AQR-GFP plasmid (RG220742) was used for the mutagenesis with KOD polymerase (Merck/Millipore, 71086□3), used according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The gelatinous sack surrounding the eggs was removed using 4% L-Cysteine (Merck Milipore, USA) and followed by microinjecting the zygotes with Morpholino antisense oligonucleotide (MO) ...
-
bioRxiv - Developmental Biology 2020Quote: ... cells fixed for 10 min with 4% paraformaldehyde (pH 7.0; prepared from paraformaldehyde powder (Merck) by heating in PBS up to 60 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... The recovered nanoparticles were pooled in Amicon Ultra-4 100 kDa centrifugal filter units (Merck) and concentrated by centrifuging at 2000 ×g until the lipid concentration was increased to 30–40 mM.
-
bioRxiv - Neuroscience 2020Quote: ... Mowiol® 4-88 used for mounting medium was purchased from Merck (Kenilworth, MJ, USA). Cell culture reagents – Ham’s-F12 ...
-
bioRxiv - Biochemistry 2021Quote: ... The purified complex I was concentrated using an Amicon Ultra-4 100K centrifugal filter (Merck) to 0.5 mg mL-1 (w/v) ...
-
bioRxiv - Biochemistry 2022Quote: ... After the standard procedure of Ni-NTA purification (Ni-NTA beads, Merck, cat. 70666-4) and Sumo protease cleavage (in-house production ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 % glycerol) freshly supplemented with 5µg/ml Poly(dI-dC) (Merck Life Science cat. P4929) and 0.5 mM DTT ...
-
bioRxiv - Biochemistry 2021Quote: ... The active fraction was concentrated using a 50 kDa cutoff filter Amicon Ultra-4 (Merck), and of 20 μL was mixed with 2 μL of 5.9 mM coelenterazine and 278 μL of 20 mM Bis-Tris-HCl (pH 7.0) ...
-
Nerve pathology is prevented by linker proteins in mouse models for LAMA2-related muscular dystrophybioRxiv - Neuroscience 2022Quote: ... General histology was assessed after tissue fixation with 4% paraformaldehyde by H&E staining (Merck) or Picro Sirius Red stain (Direct Red 80 (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... Antibodies used for ChIP were anti-H3K4me3 (Merck Millipore, 04–745, 4 μl per ChIP), anti-H3K27me3 (Merck Millipore ...
-
bioRxiv - Pathology 2020Quote: ... the harvested tissues were immediately fixed in 4% (w/v) paraformaldehyde (PFA; Merck, Darmstadt, Germany) for 24 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... After treatment for the indicated time the cells were fixed in 4% paraformaldehyde (Merck, 100496,) and permeabilized with cold methanol at −20°C for 2 min or 0.1% TX-100 in PBS for 5 min at room temperature followed by blocking with 0.12% glycine (Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... 21,000 x g at 4°C and sterile-filtered using a 0.45µm PVDF-membrane (Merck).
-
bioRxiv - Molecular Biology 2022Quote: ... Rad54 was concentrated using an Amicon Ultra-4 (50 k) centrifugal filter (UFC805008, Merck Millipore).
-
bioRxiv - Neuroscience 2024Quote: ... and incubated o/n at 4°C with the primary antibodies (Rabbit-antiGFAP: MAB3402, Merck Millipore ...
-
bioRxiv - Plant Biology 2024Quote: ... 4 mM phosphoenolpyruvate (PEP)) as well as 1.2 U pyruvate kinase (P1506; Sigma-Aldrich/Merck) were added to convert ADP and PEP to ATP and pyruvate ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... determined by means of quantitative NMR using TraceCERT® ethyl 4-(dimethylamino)benzoate from Merck as an internal calibrant [48 ...
-
bioRxiv - Cell Biology 2024Quote: ... The supernatant was then concentrated through an Amicon Ultra-4 Filter Unit (Merck, cat#UFC8100214). The validation of the cytoplasm fraction was performed by western blot using antibodies against markers for nucleus (H2A) ...
-
bioRxiv - Immunology 2024Quote: ... cells were treated for 4 h with 5 mg/ml Brefeldin A (Merck, Darmstadt, Germany) after 140 h incubation time ...
-
bioRxiv - Biochemistry 2024Quote: ... Fractions containing ELAC2 were concentrated using Amicon Ultra-4 30K Centrifugal Filter Devices (Merck Millipore), aliquoted ...
-
bioRxiv - Cell Biology 2023Quote: ... and 0.1% X-Gal (from a 4% X-Gal solution in dimethylformamide, Merck Life science). Buffer was passed through a 0.2 micron syringe filter before X-Gal was added ...
-
bioRxiv - Cell Biology 2023Quote: ... sections were rehydrated and stained with haematoxylin (Fluka) for 4 min and with eosin (Merck) for 2 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... membranes were stained with Ponceau S and subsequently blocked in 4% BSA (A8022, Sigma/Merck) in 1x PBS-Tween (137 mM NACl ...
-
bioRxiv - Cell Biology 2023Quote: ... 20 µM trans- Epoxysuccinyl-L-leucylamido(4-guanidino)butan (E64, Sigma-Aldrich, Merck, Taufkirchen, Germany) was added ...
-
bioRxiv - Immunology 2023Quote: ... cells were fixed for 30 min at 4°C with 0.4 % paraformaldehyde (PFA, Merck KGaA) and permeabilized by washing twice with permeabilization buffer (PBS containing 2 % FBS and 0.1 % saponin (Sigma)) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The gelatinous sack surrounding the eggs was removed using 4% L-Cysteine (Merck Milipore, USA) and followed by microinjecting the zygotes with antisense MOs ...
-
bioRxiv - Genetics 2023Quote: ... individual fibers were transferred onto a 4-well chamber slide (Nunc Lab-Tek, Merck, GmbH) containing HBSS with 2.5μM FM1-43 dye (Molecular Probes ...
-
bioRxiv - Biochemistry 2023Quote: ... After the standard Ni-NTA purification process using Ni-NTA beads (Merck, cat. 70666-4) and subsequent Sumo protease digestion (concentration of sumo protease at 1:200) ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were then fixed and permeabilized using a combination of 4% paraformaldehyde (Sigma-Aldrich/Merck) and 0.1% Triton X-100 (Sigma-Aldrich/Merck) ...
-
bioRxiv - Biochemistry 2023Quote: ... samples were concentrated at 3,500 rpm and 4°C using Amicon Ultra centrifugal units (Merck).
-
bioRxiv - Neuroscience 2023Quote: ... and transcardially perfused with 0.9% NaCl followed by 4% paraformaldehyde (PFA, Sigma, Merck, Germany, P6148). The brains were harvested and post-fixed overnight in 4% PFA at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... permeabilized with 0.1% saponin in PBS and incubated with 4 μg/ml Hoechst 33342 (Merck) for 10 min at room temp ...
-
bioRxiv - Biochemistry 2024Quote: ... We then stimulated the cells for 4 h with 100 ng/ml PMA (524400; Merck) and 1 µg/ml ionomycin (407952 ...
-
bioRxiv - Cell Biology 2024Quote: Cultured cells for 24 hours of incubation were fixed with 4% paraformaldehyde (PFA) (#104005, Merck) in Hank’s balanced salt solution containing 1 mM Ca2+ and Mg2+ ...
-
bioRxiv - Microbiology 2024Quote: ... and used to transduce HeLa cells in the presence of 4 µg/ml polybrene (Merck). At 24 hours post-transduction ...
-
bioRxiv - Systems Biology 2024Quote: ... UK) and separated by gel electrophoresis (7.5% acrylamide, 4 mg/ml porcine gelatin; Merck, UK). SDS was removed by washing in 50 mM Tris.HCl ...
-
bioRxiv - Cell Biology 2024Quote: ... and separated on mPAGE™ 4-12% Bis-Tris Precast Gels (Merck, MP41G10 or MP41G12) through standard SDS-PAGE protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Nucleoproteins were separated by electrophoresis on 6/12% sodium dodecyl sulfate (SDS) polyacrylamide gels and blotted onto polyvinylidene difluoride (PVDF) membranes (Merck Millipore, Darmstadt, Germany). After blocking for 1 h with 5% bovine serum albumin ...
-
bioRxiv - Molecular Biology 2021Quote: ... washed and resuspended in PBS and measured by flow cytometry (FACS) using the Guava Easy Cyte 6-2 L system (Merck Millipore, Schwalbach, Germany). Fluorescence was excited at 488nm and BODIPY emission was recorded at 530 and 585 nm ...
-
bioRxiv - Molecular Biology 2021Quote: ... Apoptotic cell death was detected by annexin-V/propidium iodide staining and subsequent flow cytometry analysis using the Guava Easy Cyte 6-2 L system (Merck Millipore, Schwalbach, Germany). Annexin-V-FITC emission was detected with the green filter at 525/530 nm ...
-
bioRxiv - Neuroscience 2020Quote: Different cellular and mitochondrial parameters of the glutamate- or erastin-induced cell death pathways were analyzed using the Guava easyCyte 6–2L flow cytometer (Merck Millipore, Darmstadt, Germany) upon harvesting adherent HT22 cells and following addition of different fluorescent dyes.
-
bioRxiv - Biophysics 2022Quote: ... equal amounts of GFP and SNAP-tagged recombinant WT-FUS protein (yielding a total protein concentration of 6 μM) were gently mixed into an aqueous solution of 20 % PEG-35 (Merck KGaA, Darmstadt, Germany) and 500 mM KCl (Merck KGaA ...
-
bioRxiv - Cell Biology 2024Quote: ... the qRT-PCR was performed with custom designed Thermo Fisher probes (Supplemenatary table 6) using Universal Sybr Green Master Rox (Merck Life Sciences, 4913850001) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... α: β: γ: δ = 1:1:1:1 was obtained from Merck (Darmstadt, Germany).