Labshake search
Citations for Merck :
1101 - 1150 of 1249 citations for 3 Trifluoromethylthio benzeneboronic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... reagent (chlortrimethylsilane [Merck KGaA, Darmstadt, Germany]/1.1.1.3.3.3-Hexamethyldisilasane [Sigma Aldrich, Co., St. Louis, MO, U.S.A]/pyridine [Merck KGaA, Darmstadt, Germany], 9:3:1) in a GC vial for GC-MS-SIM non-cholesterol analysis ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Biophysics 2023Quote: ... The C378A or C406A variants of 15N-pm-β2AR-Cter were labeled on the remaining cysteine using 3-(2-Iodoacetamido)-proxyl (Merck). Paramagnetic samples were recorded with a recycling delay of 2 s ...
-
bioRxiv - Immunology 2024Quote: ... we included anti-human PD-1 IgG4 S228P antibody (10μg/ml, 1B8/HuPD1B-3, Merck & Co., Inc., Rahway, NJ, USA). For TIM-3 blockade (αTIM-3) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-total-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (anti-tAMPAR) (Cat.#AB1504, Merck Millipore, Burlington, MA, USA), anti-phospho (Ser845)-AMPAR (anti-pAMPAR;cat.#AB5849 ...
-
bioRxiv - Neuroscience 2024Quote: ... or (2) collected 3 days after transfection and enriched by filter device (Amicon Ultra-15 Centrifuge Filters, Merck, Cat#UFC910008). Viral pellets were resuspended in sterile PBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... Then 500 μL Nuclear RNA wash buffer (10 mM Tris pH 7.4, 10 mM NaCl, 3 mM MgCl2, 1% BSA (Merck, #B9000S), 0.1% Tween (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... the marine nanofibers were washed three times with 500 μL of ultrapure water using an Amicon Ultra-0.5 Centrifugal Filter Unit (3 kDa cutoff) (Merck Millipore). The collected marine nanofibers were dropped onto a copper grid ...
-
bioRxiv - Immunology 2024Quote: Human monocytes were plated at 2 × 105 cells/well in 96 well plates and cultured for 2-3 days in RPMI supplemented with 10% human serum (from human male AB plasma, Merck), 1 U/mL penicillin and 0.1 mg/mL streptomycin ...
-
bioRxiv - Microbiology 2024Quote: ... LS-ARS2 overnight culture was inoculated (1% v/v) in MRS broth adjusted to pH 4 and pH 3 with HCl (1N, Merck), followed by incubation for 0 ...
-
bioRxiv - Microbiology 2024Quote: ... hsa-miR-21-5p scramble microRNA mimic and a double-stranded small RNA oligonucleotide control (sequence: 5’- GGAACGCCAACCGAAGUCUA - 3’) (all from Merck) were added to achieve a final concentration of 250 nM on each well ...
-
bioRxiv - Molecular Biology 2024Quote: ... cell pellets were resuspended in 500 μL Nuclear RNA lysis buffer (10 mM Tris pH 7.4, 10 mM NaCl, 3 mM MgCl2, 1% BSA (Merck, #B9000S), 0.1% Tween (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purification of the labelled proteins was done by repeated filtration in a 3 kDa filter (Amicon Ultra-15 Centrifugal Filter Unit, Merck).
-
bioRxiv - Neuroscience 2024Quote: ... Slices were then washed in PBS and incubated in 0.2% Sudan black in 70% ethanol at room temperature for 3 minutes to minimize autofluorescence and mounted on glass slides (Menzel-Gläser) with FluorSave (Merck Millipore).
-
bioRxiv - Neuroscience 2024Quote: ... After washing 3 times for 10 minutes with PBS, slices were mounted on glass slides (J2800AMNZ, Epredia) with FluorSave (345789, Merck).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Zn and Mn extraction from earthworm tissue was performed using Teflon vessels and 7 mL of reverse aqua regia (3:1 ratio of HCl:HNO3; Merck, Darmstadt) on hot plates in an open system ...
-
bioRxiv - Physiology 2024Quote: ... followed by 7 days treatment with primary antibodies diluted 1:10,000 in 100 ml immunostaining buffer (3% horse serum, 10% CHAPS (Merck, 220201), 2% Triton X-100 ...
-
bioRxiv - Biochemistry 2024Quote: Lipids (1 mg from the brain and 3–5 mg from the testis) were separated via TLC (Silica Gel 60 TLC plate, Merck) with methyl acetate/2-propanol/chloroform/methanol/0.25% calcium chloride in water (25:25:25:10:9 ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by signal development for 6–24 h in a solution containing nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Merck). The samples were covered with glass coverslips using CC/Mount (Merck) ...
-
bioRxiv - Biochemistry 2024Quote: ... and untransfected cells were cultured for 2 weeks in a complete medium containing 3 μM N-[(1R,2R)-1- (2,3-dihydro-1,4-benzodioxin-6-yl)-1-hydroxy-3-pyrrolidin-1-ylpropan-2-yl]nonanamide (Genz-123346) (Merck, Darmstadt, Germany), a glucosylceramide synthase inhibitor [26].
-
bioRxiv - Cancer Biology 2024Quote: ... at a multiplicity of infection (MOI) of 2–3 in the presence of 5 µg/ml polybrene (Hexadimethrine bromide, Merck). For creating stable SCC13 cell lines expressing YAP- or TAZ-targeting shRNAs ...
-
bioRxiv - Cancer Biology 2024Quote: ... Dried pellet was mixed with Lysis buffer (9M urea, 4 wt% CHAPS, 2% Pharmalyte carrier ampholyte pH 3-10, Merck) and left overnight at room temperature ...
-
bioRxiv - Developmental Biology 2024Quote: ... MPI (10-5M Methimazole, Merck/Supelco CAT#M8506; 10-6M Potassium perchlorate KClO4, Merck/Sigma-Aldrich CAT#460494; 10-7M Iopanoic Acid, Merck/Sigma-Aldrich CAT#14131; in DMSO), T3+IOP (10-7M 3,3′,5-Triiodo-L-thyronine ...
-
bioRxiv - Microbiology 2020Quote: ... were percussed until the amoebae detached and 1mL of the culture media was filtered through a 3 µm cellulose acetate membrane (Merck, Germany) to retain the A ...
-
bioRxiv - Genomics 2022Quote: ... in 3×250 ml bottles and resuspended in 100 ml prewarmed 30°C YPD supplemented with 50 ug/ml Pronase (Merck 10165921001), at which point the count-up for the time course was initiated ...
-
bioRxiv - Immunology 2021Quote: ... Histone neutralisation experiments were performed via intraperitoneal injection with dialysed and combined a-Histone 3 and a-Histone 4 antibodies (Merck Millipore) or control polyclonal rabbit IgG (BioXCell) ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Biochemistry 2020Quote: ... proteins were transferred to 100 mM bicarbonate buffer (pH 8.2) by using Amicon® Ultra Centrifugal Filters (3 kDa MWCO, Merck, USA) and mixed with 1 ...
-
bioRxiv - Microbiology 2021Quote: ... The cells were washed off the filter with an ice-cold freshly prepared mixture of methanol/ethanol/chloroform (1:3:1) (ethanol LiChroSolv©, Merck, Darmstadt ...
-
bioRxiv - Cell Biology 2021Quote: ... rinsed four times with MTSB and treated for one hour at RT with 10% dimethylsulfoxide + 3% Igepal CA-630 (Merck # I3021) dissolved in MTSB ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 × 105 Cas9 TNG MKOS MEFs were transduced with either a non-targeting control sgRNA or Zfp266 sgRNA lentivirus at an MOI of 3 with 8 µg ml−1 polybrene (Merck-Millipore) for 4 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transduced with either a non-targeting control sgRNA or Zfp266 sgRNA lentivirus at an MOI of 3 with 8 µg ml−1 Polybrene (Merck-Millipore) for 4 hours ...
-
bioRxiv - Biochemistry 2022Quote: ... were combined and concentrated using an Amicon concentrator tube (30 kDa MWCO for the Nb- fused biosensors, 3 kDa MWCO for HER2-Nb) (Merck-Millipore). A final volume < 5 mL was loaded onto a SEC column (HiLoad 200pg ...
-
bioRxiv - Cell Biology 2022Quote: ... crescentus cultures were grown overnight at 30 °C in 3 ml of 2x PYE49 (Peptone, Merck, #82303; Yeast Extract, Merck, #Y1626) medium under mechanical agitation (200 rpm) ...
-
bioRxiv - Cell Biology 2022Quote: ... crescentus cultures were grown overnight at 30 °C in 3 ml of 2x PYE49 (Peptone, Merck, #82303; Yeast Extract, Merck, #Y1626) medium under mechanical agitation (200 rpm) ...
-
bioRxiv - Systems Biology 2022Quote: ... UK) previously coated with calf-skin collagen (15 μg/cm2 and fibronectin 3 μg/cm2; both Merck Life Science UK Ltd.). The permeability of hCMEC/D3 cell monolayers to 70 kDa FITC-dextran (2 mg/ml ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-DIV cultured human spinal motor neurons and C5-C7 ventral horns of adult animals 3 days after surgery were estimated using a Rac1/Cdc42 Activation Assay Kit (#17-441, Merck Millipore). Briefly ...
-
bioRxiv - Developmental Biology 2020Quote: ... membranes were washed 3 times with TBS-T and subjected to chemiluminescence detection with Immobilon Western Chemiluminescent HRP (Horseradish Peroxidase) Substrate (Merck Millipore) using a Gel-Doc XR+ System (BioRad) ...
-
bioRxiv - Immunology 2020Quote: ... Peptides were separated from the HLA molecule remnants by ultrafiltration employing 3 kDa and 10 kDa Amicon filter units (Merck Millipore) for HLA-I and HLA-II ...
-
bioRxiv - Microbiology 2020Quote: ... primers 1022700 5F and R were used to amplify the 572 bp 5’ homology flank and primer pair 1022700 3F and R was used to amplify the 673 bp 3’ homology flank (KOD Hot Start DNA Polymerase, Merck Millipore) which were cloned on either side of the sfGFP expression cassette in pkiwi003 (Ashdown et al. ...
-
bioRxiv - Plant Biology 2020Quote: ... samples were resuspended in Urea 7 M and Thiourea 2 M buffer and desalted on Amicon Ultra-0.5 3 kDa centrifugal filters (Merck Millipore, Germany). Filters were filled to maximum capacity with buffers and centrifuged at 15,000 g for 10 min at 20°C ...
-
bioRxiv - Microbiology 2020Quote: ... The media was further concentrated to ~3 ml with a 100 kDa cut-off centrifugal concentrator filter (Amicon Ultra, Merck Millipore) and layered onto a 20-60% w/v sucrose density gradient in PBS buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... bacteria were grown to mid-logarithmic phase at 37 °C in 3% (w/v) tryptic soy broth (Merck KGaA, Darmstadt, Germany). The microbial culture was washed twice by centrifugation and re-suspended in fresh 10 mM Tris buffer (pH 7.4 at 37 °C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Eluted protein samples were combined in one tube and desalinated using an ultrafiltration tube (Amicon Ultra 3 kDa molecular weight cut-off, Merck/Millipore) with Buffer C (50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...
-
bioRxiv - Microbiology 2020Quote: ... In the first tube, 6 ml of amniotic fluid was dissolved in 3 ml of glycerol (≥99 %, G2025, Sigma-Aldrich (Merck), Overijse ...
-
bioRxiv - Microbiology 2023Quote: ... Clear lysates were subsequently filtered through 10 kDa followed by 3 kDa Amicon Ultra-0.5 centrifugal filters (Merck KGaA, Darmstadt, Germany) to generate sub-cellular fractions with molecular size of larger than 10 kDa ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were washed in PBS for 3 times and Alexa Fluor 555 conjugated secondary goat anti-mouse IgG antibody (1:100; Merck, Germany) was added for immunostaining in the dark for 2 hours at RT ...
-
bioRxiv - Cell Biology 2023Quote: J774A.1 macrophages with or without infection (3 hour) were lysed in a specific lysis buffer containing DCP-Bio1 (Merck # NS1226) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... with PBS pH 7.4 for 10 min at 4400 x g and 4°C using an Amicon Ultra-4 concentrator with 3 kDa cutoff (Merck Millipore). The degree of labelling (DOL = 1.96 ...