Labshake search
Citations for Merck :
1051 - 1100 of 4416 citations for 3 1 Pyrrolidinylmethyl phenyl magnesium bromide solution since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were washed with PBS and fixed for at least 3 h with 70% ethanol (Merck, 100983). Cells were washed with PBS and analyzed by using the Cell Cycle Kit (Luminex Corporation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was transferred to Amicon Ultra-0.5 Centrifugal Filter Unit 3 kDa (Merck Millipore catalogue no. UFC500396) and centrifuged for 45 min at 4 °C at 12,000g ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein-containing fractions were pooled and concentrated on an Amicon 3 kDa MWCO spin concentrator (Merck Millipore). After another IMAC purification step using Ni-NTA resin ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... The desired concentration was achieved using Amicon® Ultra centrifugal filter units (3 kDa cutoff – Merck Millipore).
-
bioRxiv - Immunology 2022Quote: ... for 1 hour at RT and washed 3 times with TBS/Tw (TBS containing 0.05% v/v Tween-20 (8.17072.1000, Merck)) ...
-
bioRxiv - Biochemistry 2022Quote: ... The aE11-Fab sample was concentrated by centrifugal concentrator with a MWCO of 3 kDa (Merck Millipore) and further purified by size exclusion chromatography into 20 mM Tris ...
-
bioRxiv - Cell Biology 2024Quote: ... they were washed four times for 3 minutes with PBS and mounted in Mowiol reagent (81381, Merck). The image acquisition was done on a Zeiss LSM880 confocal microscope running the software Zeiss ZEN2.3 SP1 FP3 (black ...
-
bioRxiv - Bioengineering 2023Quote: ... unreacted biotin-pentylamine was removed by ultrafiltration with a 3 or 10 kDa MWCO membrane (Merck Millipore). The recovered upper residual liquid (∼100 μL ...
-
bioRxiv - Systems Biology 2023Quote: ... Shimadzu) with a Discovery HS F5 column (2.1 mm i.d. × 150 mm, 3 μm particle size, Merck) coupled with a Q Exactive instrument (PFPP-LC/MS/MS) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The gelatinous sack surrounding the eggs was removed by incubation in 3% L-Cysteine (Merck Millipore, USA) while rotated by hand for 15 minutes ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μl of N,N,N’,N’-Tetramethylethylendiamine (TEMED, #612-103-00-3, Sigma-Aldrich now Merck) was added to 1 ml of the monomer solution ...
-
bioRxiv - Biochemistry 2022Quote: ... Shimadzu) with a Discovery HS F5 column (2.1 mm i.d. × 150 mm, 3 μm particle size, Merck) coupled with a Q Exactive instrument ...
-
bioRxiv - Biochemistry 2022Quote: ... # T7408) using an ultrafiltration cartridge (Amicon Ultra 0.5 mL 3 K; Merck, Readington, NJ, USA; Cat. # UFC500324). The total protein levels in the samples were assayed using the Pierce™ BCA Protein Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... by submersion in 160 mg/l MS-222 (ethyl 3-aminobenzoate methanesulfonate; Sigma-Aldrich, Merck, Darmstadt, Germany) dissolved in tank water ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The cell extracts were concentrated using Amicon Ultra-15 3 kDa cutoff (Merck Millipore, Burlington, MA, USA). The obtained cell extract was flash-frozen in liquid nitrogen and preserved at −80 °C until further use.
-
bioRxiv - Biophysics 2022Quote: ... and were dissolved in a mixture of chloroform / methanol (7:3 vol/vol, both from Merck KGaA) to yield four stock solutions at 1.5 mM lipid concentration ...
-
bioRxiv - Cancer Biology 2023Quote: ... glutamine-free RPMI was supplemented with 2mM [1,5-15N]-L-Glutamine or [3-13C]-L-Glutamine (Merck).
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Cell Biology 2024Quote: ... The eluate from each column was pooled and concentrated in a 3 KD amicon column (Merck, UFC5003) to just under 100 μl ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were later exposed to a 3% bovine serum albumin (BSA, A3912, Merck Life Science, Milan, Italy) solution in DPBS containing 0,1% Triton at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Plant Biology 2024Quote: ... patens grown on PpNH4 were homogenized in 2 mL tubes using 3-mm zirconium glass beads (Merck) in presence of 500 µL of cold TEN buffer (Tris-HCl 100 mM ...
-
bioRxiv - Cancer Biology 2024Quote: ... the AQR-GFP plasmid (RG220742) was used for the mutagenesis with KOD polymerase (Merck/Millipore, 71086□3), used according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... Conjugated HEL-OVA solution was further purified from unconjugated proteins using a 50 kDa Amicon filter tube (Merck).
-
bioRxiv - Cancer Biology 2022Quote: Mayer’s haematoxylin solution was prepared by dissolving 5 g of aluminium potassium sulphate dodecahydrate (Merck Millipore, cat. 1010421000) in 100 mL of water ...
-
bioRxiv - Molecular Biology 2021Quote: ... Slices were then stored at 4°C in a PBS-solution containing 0.05% of Proclin (Merck, Darmstadt, Germany) until further processing.
-
bioRxiv - Developmental Biology 2020Quote: ... Larvae were placed in 12-well plates and incubated with 0.2% fresh Oil Red solution in Isopropanol (Merck) for 15 min ...
-
bioRxiv - Bioengineering 2021Quote: ... Cetuximab antibody (Erbitux infusion solution, 5 mg/mL) was used to target EGFR and was purchased from Merck Serono ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The specimens were then washed with water and stained with Weigelt’s iron hematoxylin solution (C.I.75290, Merck-Millipore) for 10 minutes at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: Primary human macrophages (pMФ) were isolated from the whole blood of healthy volunteers with Biocoll separating solution (Merck) according to the manufacturer’s protocol and seeded at a density of 2×106 cells per well in a 6-well plate ...
-
bioRxiv - Microbiology 2021Quote: ... This crude enzyme solution was desalted using ultra centrifugal filters of 10 kDa cutoff value (Amicon Ultra, Merck) and then loaded on a 15 mm× 200 mm DEAE cellulose column pre-equilibrated with 20 mM Tris-Cl buffer (pH 7.5) ...
-
bioRxiv - Cell Biology 2020Quote: ... An anti-DIG antibody conjugated to alkaline phosphatase and BM purple alkaline phosphatase substrate precipitating solution (Merck Roche) were used for staining ...
-
bioRxiv - Immunology 2022Quote: ... Tween-20 detergent (Cat no.-655205-250ML) and TMB solution (Cat no.-CL07-1000MLCN) were purchased from Merck. Bradford reagent (Cat no.-5000006 ...
-
bioRxiv - Neuroscience 2022Quote: ... The next day the slides were cleared in xylene and coverslipped with DPX-new mounting solution (Merck Millipore). The anti-pMLKL antibody purchase from Abcam (ab196436 ...
-
bioRxiv - Systems Biology 2020Quote: ... which includes 5% of PBS buffer and 5% acetonitrile in 0.15 M sodium chloride solution (Merck, Darmstadt, Germany). The pH of equilibration buffer was 7.2 ...
-
bioRxiv - Pathology 2022Quote: ... The specimens were then washed with water and stained with Weigelt’s iron hematoxylin solution (C.I.75290, Merck-Millipore) for 10 minutes at room temperature ...
-
bioRxiv - Biophysics 2022Quote: ... The solution was concentrated by ultrafiltration using Amicon Ultra centrifugal filters with 100 kDa molecular weight cutoff (Merck) and passed over a Superdex 200 26/60 gel filtration column (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... the solution was exchanged with phosphate buffered saline (PBS) using Amicon Ultra-15 10K Centrifugal Filter Devices (Merck). Purity was confirmed by the absence of contamination bands on SDS-PAGE.
-
bioRxiv - Immunology 2020Quote: ... fixed with paraformaldehyde (4% w/v (Applichem) in phosphate-buffered solution (PBS)) and used for Giemsa-staining (Merck) to calculate the number of perivascular neutrophils ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Mononuclear cell (MNC) fractions were purified by gradient centrifugation with Biocoll cell separation solution (Merck Millipore, Darmstadt, Germany). Leukemic cells were enriched by negative selection with a combination of CD3- ...
-
bioRxiv - Biochemistry 2020Quote: ... One and a half μl of protein solutions were mixed on the target plate with 0.5 μl of the 20% 2,5-dihydroxybenzoic acid (Merck) solution in 20% ACN ...
-
bioRxiv - Cell Biology 2021Quote: ... Sections were washed and incubated with bisbenzimide (10 min in 2.5 μg/ml solution in PBS; Merck KGaA). Images were collected using an SP2 Leica confocal microscope (Leica Microsystems ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The specimens were then washed with water and stained with Weigelt’s iron hematoxylin solution (C.I.75290, Merck-Millipore) for 10 minutes at room temperature ...
-
bioRxiv - Genomics 2020Quote: ... The protein solutions were subsequently desalted and protein amount was estimated using Direct Detect cards (Merck Millipore, Darmstadt). All samples were freeze dried before further processing ...
-
bioRxiv - Microbiology 2020Quote: ... insoluble aggregates in the DesX solution were removed by centrifugal filtration using an Ultrafree-MC filter (Merck Millipore). The protein concentration was determined by the Bradford method (41 ...
-
bioRxiv - Pathology 2023Quote: ... and then placed in a freeze protective solution (dimethyl sulfoxide in 125 mM PB with 20% glycerol, Merck Life Science AS/Sigma Aldrich Norway AS ...
-
bioRxiv - Plant Biology 2023Quote: ... The instrument was filled with a solution of purified water (Milli-Q Plus; Merck Millipore, Billerica, MA, USA) which was degassed (1.0 × 5.5 Mini Module ™ ...
-
bioRxiv - Microbiology 2022Quote: ... the mice were inoculated orally using a pipette with 50 µl 1M bicarbonate solution (Merck, cat. no. S5761) that 5 min later was followed by oral gavage with 0.15 mL FVT/Saline solutions (FVT/Saline ...
-
bioRxiv - Biophysics 2022Quote: ... The protein solution was filtered through 0.22 μm hydrophilic polyethersulfone (PES) membrane filter (Cat#SLGP033NS, Merck Millipore, USA) and stored as 1.0 mL aliquots at −80 °C until crystallization experiments ...
-
bioRxiv - Bioengineering 2024Quote: ... mice were sedated and exsanguinated by cardiac puncture into 100 µL citrate-phosphate-dextrose solution (Merck Life science). Blood was centrifuged for 2 x 10 min at 2500 x g ...