Labshake search
Citations for Merck :
1001 - 1050 of 4416 citations for 3 1 Pyrrolidinylmethyl phenyl magnesium bromide solution since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Bioengineering 2024Quote: ... and the elution fractions were concentrated with Amicon Ultra centrifugal filter units (3 kDa, UFC800324, Merck) to a concentration of 0.24 mg/mL (3.6 µM) ...
-
bioRxiv - Biochemistry 2024Quote: ... The protein mixture was concentrated using Amicon Ultra 3 kDa MW cut-off device (Merck Millipore) to ∼15 mg/ml and used to set up commercial crystallisation screens using the sitting drop vapour diffusion method at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: ... the solution transferred to cryo vials and then cooled down in CoolCell™ LX Freezing Containers (Merck) in a −80°C freezer ...
-
bioRxiv - Developmental Biology 2020Quote: ... The slides were then washed in distilled water and subjected to the filtered Giemsa dye solution (Merck) diluted 1:20 in distilled water for 20 min at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... All ELISAs were developed with 100 µl substrate solution per well containing 0.11 M sodium acetate (Merck), 0.1 mg/mL 3,5,3’,5’-tetramethylbenzidine (TMB ...
-
bioRxiv - Microbiology 2021Quote: ... Pulled glass capillaries with a silver wire and filled with Ringer solution (Merck Millipore, product no.: 115525) were placed on the tip of the funiculus and in the eye as recording and ground electrodes ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Stock solutions and media were prepared with ultrapure MilliQ water (>18.2Ω MilliQDirect system, Merck Millipore, Darmstadt, Germany).
-
bioRxiv - Neuroscience 2020Quote: The anionic liposome (AL) solution was freshly made of 5.5mg/mL L-α-Lecithin (Merck Millipore, 524617) and cholesterol 1.18mg/mL (Merck Millipore ...
-
bioRxiv - Immunology 2022Quote: ... 18 mm) were coated with 0.01% poly-l-ornithine solution (A-004-C, Merck-Millipore, Massachusetts, USA) in the dark ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... they were incubated in alcian blue staining solution (alcian blue 8GX, C.I.74240, Merck-Millipore, Burlington, MA) for 10 minutes at room temperature ...
-
bioRxiv - Biophysics 2022Quote: ... Dendrimer solutions were filtered through a 0.22 μm Millex RB sterile syringe filter (Merck Millipore, Madrid, Spain) attached to a syringe and applied directly on the substrates ...
-
bioRxiv - Neuroscience 2020Quote: Sections were washed in PBS and blocked for 1 h with a PBSGT solution (1X PBS, 0.2% gelatin, 0.25% Triton X-100) containing 0.1 M lysine (Merck). Sections were then incubated overnight at room temperature in the PBSGT solution with the following primary antibody ...
-
bioRxiv - Cell Biology 2022Quote: ... the zona pellucida was removed before fixation by treating cells with Tyrode’s acidic solution (Merck, T1788-100ML) as described previously (52) ...
-
bioRxiv - Biophysics 2022Quote: ... the solution concentrated by ultrafiltration using Amicon Ultra centrifugal filters with 10 kDa molecular weight cutoff (Merck) and passed over a Superdex 75 26/60 gel filtration column (GE Healthcare ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The concentrations that were used for the treatment were: 50 µM roscovitine (50 mM solution from Merck); 10 mM hydroxyurea (SigmaAldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... all solutions were degassed by vacuum-driven filtration (Stericup 500 mL Durapore 0.45 μm PVDF, Merck Millipore). Before loading ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... they were incubated in alcian blue staining solution (alcian blue 8GX, C.I.74240, Merck-Millipore, Burlington, MA) for 10 minutes at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... The substrate solution had previously been prepared by adding one o-Phenylenediamine dihydrochloride tablet (OPD, Sigma-Merck) to 20 mL of a citrate buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... A total of 1.2 mL of a 10 mM sodium periodate solution (Merck, cat# 7790-28-5) was added to the suspension ...
-
bioRxiv - Developmental Biology 2023Quote: ... 400 µl of solution of recombinant TnC (Supplementary Materials and Methods) or purified human TnC (Merck Millipore) (15 µg/ml in 0.01% PBS-Tween ...
-
bioRxiv - Neuroscience 2022Quote: ... Permeabilization of brain sections was done using a phosphate buffer solution containing 0.5% TritonX-100 (Merck KGaA). Blocking was done with 5% normal goat serum (Abcam ...
-
bioRxiv - Microbiology 2022Quote: ... in permeabilisation solution (0.5% v/v bovine serum albumin and 0.1% v/v Saponin (Merck, Glasgow, UK) in PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... cryoprotected several days in a solution of PBS 0.01 mM/sucrose 30% (w/v, 1076511000, Merck Millipore), and then cut into 50 μm slices with a sliding microtome (SM2010 R ...
-
bioRxiv - Neuroscience 2023Quote: ... Viral particles solution was collected and ultrafiltered with Amicon Ultra-15 centrifugal filters (100 kDa, Merck, Germany) to obtain the pure AAVs solution for animal administration.
-
bioRxiv - Neuroscience 2023Quote: ... in phosphate-buffered saline (PBS) and subsequently blocked in a solution containing 2% normal goat serum (Merck) within the same permeabilization solution ...
-
bioRxiv - Developmental Biology 2022Quote: ... Staining was achieved by adding a solution of 4-Nitro blue tetrazolium chloride (NBT, 11383213001, Merck-SIGMA) and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP ...
-
bioRxiv - Bioengineering 2022Quote: Unfixed U2OS cells were incubated in a prewarmed solution of 0.2% Saponin (#47036, Sigma-Aldrich now Merck) in Cytoskeleton Buffer (CB ...
-
bioRxiv - Immunology 2022Quote: ... The loading pump delivered a solution of 0.1% formic acid in 98% water / 2% acetonitrile (Merck, Germany) at 10 µL/min ...
-
bioRxiv - Bioengineering 2023Quote: ... The dye solutions were placed between two glass slides separated by a silicon insulator film (Merck, Israel). The emitted fluorescence was recorded with a NIR objective lens (5018-SW ...
-
bioRxiv - Cell Biology 2024Quote: ... The eluted protein solution was in turn transferred to an ultrafiltration column (Amicon Ultra-15, Merck Millipore) and concentrated by centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... and stock solutions were made for CECs at 20 ppm with methanol (Merck; LC-MS grade purity). The working solution was prepared prior to the experiment ...
-
bioRxiv - Microbiology 2024Quote: ... a stock citrate solution of 5 mg/mL was prepared by using tri-sodium-citrate dihydrate (MERCK). Then ...
-
bioRxiv - Neuroscience 2024Quote: ... Differentiation was then achieved by treating the sections with a 0.05% lithium carbonate solution (Merck Millipore, Germany) for 5 seconds ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... stock solution of linezolid (purity > 99 % in powder form, Sigma-Aldrich, Merck KGaA, Saint-Quentin-Fallavier, France) at 10 000 μg/mL in dimethyl sulfoxide (DMSO ...
-
bioRxiv - Physiology 2024Quote: ... Fluorescence-labeled polystyrene microspheres (latex beads) were bought as 2% or 2.5% solutions from Merck (Taufkirchen, Germany) and Thermo Fisher Scientific (Langenselbold ...
-
bioRxiv - Genetics 2024Quote: ... The chromogenic reaction was carried out by incubating the larvae in BCIP/NBT solution (Merck, Cat. 203790) in NTMT buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... The protein stock solutions were cleared from potential aggregates using small volume centrifugal filters (UFC30VV25, Merck, Germany). The protein concentrations were determined via extinction coefficient measurements at 280 nm (NanoDrop ...
-
bioRxiv - Biochemistry 2024Quote: ... The eluted protein solution was concentrated using an ultracentrifugal filter with a 50 kDa cutoff (Merck Millipore).
-
bioRxiv - Developmental Biology 2020Quote: ... all other conditions: N=3) in the presene of 4µg/ml polybrene (cat. TR-1003-G, Merck) (Supplementary Figure 2) ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Cell Biology 2020Quote: ... and proteins were eluted using 100 µl of 150 ng/µl 3× FLAG Peptide (F4799, Merck KGaA) or HA peptide (HY-P0239 ...
-
bioRxiv - Neuroscience 2022Quote: ... animals were briefly anesthetized with isofluorane and 200nl of 3 nM clozapine-N-oxide (CNO, #C0832, Merck) was infused bilaterally via implanted cannulae in ACx using a Hamilton syringe (10 μl ...
-
bioRxiv - Cell Biology 2022Quote: Depletion of Cav1 was achieved by RNAi using siRNAs with the following sequence: 5’ GCAUCAACUUGCAGAAAGA 3’ (Merck), and Control siRNA Luciferase ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 mM MgCl2) using Amicon Ultra-0.5 mL Centrifugal Filters (30 or 100 K MWCO, Merck Millipore). After re-measuring the concentrations by densitometry ...
-
bioRxiv - Biochemistry 2020Quote: ... before Rab8a was washed 3 times with PBS in an Amicon filter (Merck Millipore, 10 kDa NMWL). Incorporation of label was confirmed by MS.
-
bioRxiv - Biochemistry 2022Quote: ... Japan) with a Discovery HS F5 column (2.1 mm i.d. × 150 mm, 3 μm particle size, Merck) coupled with a LCMS-8060NX ...
-
bioRxiv - Microbiology 2021Quote: Full-length CA sequences derived from pNL4-3 was introduced to pET30a vectors (Novagen-Merck KGaA, Germany), producing a pET30a CA vector ...
-
bioRxiv - Immunology 2021Quote: ... Calu-3 cells were transduced by addition of lentiviral supernatants containing 8 μg/ml polybrene (Merck Darmstadt). 48 hours after transduction ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pH 7 using repetitive washing and centrifugation with an Amicon 3 kDa MWCO centrifugal filter (Merck Millipore). For the synthesis of ditopic A’-A’ CC ligand ...