Labshake search
Citations for Merck :
951 - 1000 of 2844 citations for Fc Receptor Like Protein 3 FCRL3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... 1 % (w/v) Bovine serum albumin and 3 % (v/v) goat serum (Merck Life Science cat. G9023). Following blocking ...
-
bioRxiv - Biochemistry 2020Quote: ... before Rab8a was washed 3 times with PBS in an Amicon filter (Merck Millipore, 10 kDa NMWL). Incorporation of label was confirmed by MS.
-
bioRxiv - Cancer Biology 2022Quote: ... and functionalized by 200 µl of a 3% (v/v) solution of hyaluronic acid (HA) (Merck, Germany) at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... Japan) with a Discovery HS F5 column (2.1 mm i.d. × 150 mm, 3 μm particle size, Merck) coupled with a LCMS-8060NX ...
-
bioRxiv - Microbiology 2021Quote: Full-length CA sequences derived from pNL4-3 was introduced to pET30a vectors (Novagen-Merck KGaA, Germany), producing a pET30a CA vector ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... excess media was removed from wells and mf were incubated with 0.5 mg/ml MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (Merck) in PBS at 37°C for 90 min ...
-
bioRxiv - Immunology 2021Quote: ... Calu-3 cells were transduced by addition of lentiviral supernatants containing 8 μg/ml polybrene (Merck Darmstadt). 48 hours after transduction ...
-
bioRxiv - Cancer Biology 2021Quote: Cell proliferation was assessed by 3-(4,5-1,2methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Merck Millipore). K562 cells (5,000/well ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... dried tissue samples (in liquid nitrogen) were dissolved in 3:2:1 mixture of HNO3 (Merck, Germany), H2SO4 (Merck ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pH 7 using repetitive washing and centrifugation with an Amicon 3 kDa MWCO centrifugal filter (Merck Millipore). For the synthesis of ditopic A’-A’ CC ligand ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were washed with PBS and fixed for at least 3 h with 70% ethanol (Merck, 100983). Cells were washed with PBS and analyzed by using the Cell Cycle Kit (Luminex Corporation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was transferred to Amicon Ultra-0.5 Centrifugal Filter Unit 3 kDa (Merck Millipore catalogue no. UFC500396) and centrifuged for 45 min at 4 °C at 12,000g ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... The desired concentration was achieved using Amicon® Ultra centrifugal filter units (3 kDa cutoff – Merck Millipore).
-
bioRxiv - Immunology 2022Quote: ... for 1 hour at RT and washed 3 times with TBS/Tw (TBS containing 0.05% v/v Tween-20 (8.17072.1000, Merck)) ...
-
bioRxiv - Biochemistry 2022Quote: ... The aE11-Fab sample was concentrated by centrifugal concentrator with a MWCO of 3 kDa (Merck Millipore) and further purified by size exclusion chromatography into 20 mM Tris ...
-
bioRxiv - Cell Biology 2024Quote: ... they were washed four times for 3 minutes with PBS and mounted in Mowiol reagent (81381, Merck). The image acquisition was done on a Zeiss LSM880 confocal microscope running the software Zeiss ZEN2.3 SP1 FP3 (black ...
-
bioRxiv - Genomics 2024Quote: ... Traps deployed by BCC were also baited with 1-octen-3-ol (Merck Life Science, Bayswater, Australia) (van Essen et al. ...
-
bioRxiv - Bioengineering 2023Quote: ... unreacted biotin-pentylamine was removed by ultrafiltration with a 3 or 10 kDa MWCO membrane (Merck Millipore). The recovered upper residual liquid (∼100 μL ...
-
bioRxiv - Systems Biology 2023Quote: ... Shimadzu) with a Discovery HS F5 column (2.1 mm i.d. × 150 mm, 3 μm particle size, Merck) coupled with a Q Exactive instrument (PFPP-LC/MS/MS) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The gelatinous sack surrounding the eggs was removed by incubation in 3% L-Cysteine (Merck Millipore, USA) while rotated by hand for 15 minutes ...
-
bioRxiv - Immunology 2022Quote: ... The coverslips were treated with 1% v/v solution of (3-acryloxypropyl)trimethoxysilane (APS, Merck - Sigma Aldrich) in ethanol for 1 h ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μl of N,N,N’,N’-Tetramethylethylendiamine (TEMED, #612-103-00-3, Sigma-Aldrich now Merck) was added to 1 ml of the monomer solution ...
-
bioRxiv - Biochemistry 2022Quote: ... Shimadzu) with a Discovery HS F5 column (2.1 mm i.d. × 150 mm, 3 μm particle size, Merck) coupled with a Q Exactive instrument ...
-
bioRxiv - Biochemistry 2022Quote: ... # T7408) using an ultrafiltration cartridge (Amicon Ultra 0.5 mL 3 K; Merck, Readington, NJ, USA; Cat. # UFC500324). The total protein levels in the samples were assayed using the Pierce™ BCA Protein Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... by submersion in 160 mg/l MS-222 (ethyl 3-aminobenzoate methanesulfonate; Sigma-Aldrich, Merck, Darmstadt, Germany) dissolved in tank water ...
-
bioRxiv - Microbiology 2022Quote: ... cells were fixed and permeabilized with a 3:1 mixture of methanol (Klinipath)-glacial acetic acid (Merck) for 10 min ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The cell extracts were concentrated using Amicon Ultra-15 3 kDa cutoff (Merck Millipore, Burlington, MA, USA). The obtained cell extract was flash-frozen in liquid nitrogen and preserved at −80 °C until further use.
-
bioRxiv - Biophysics 2022Quote: ... and were dissolved in a mixture of chloroform / methanol (7:3 vol/vol, both from Merck KGaA) to yield four stock solutions at 1.5 mM lipid concentration ...
-
bioRxiv - Bioengineering 2022Quote: ... The coverslips were treated with 1% v/v solution of (3-acryloxypropyl)trimethoxysilane (APTS, Merck - Sigma Aldrich) in ethanol for 1 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... glutamine-free RPMI was supplemented with 2mM [1,5-15N]-L-Glutamine or [3-13C]-L-Glutamine (Merck).
-
bioRxiv - Cell Biology 2024Quote: ... The eluate from each column was pooled and concentrated in a 3 KD amicon column (Merck, UFC5003) to just under 100 μl ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were later exposed to a 3% bovine serum albumin (BSA, A3912, Merck Life Science, Milan, Italy) solution in DPBS containing 0,1% Triton at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Plant Biology 2024Quote: ... patens grown on PpNH4 were homogenized in 2 mL tubes using 3-mm zirconium glass beads (Merck) in presence of 500 µL of cold TEN buffer (Tris-HCl 100 mM ...
-
bioRxiv - Cancer Biology 2024Quote: ... the AQR-GFP plasmid (RG220742) was used for the mutagenesis with KOD polymerase (Merck/Millipore, 71086□3), used according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... incubated with rabbit-α-pH3Ser10 (1:250 for 3 hours at room temperature; Merck Millipore, Burlington, MA), incubated with goat-α-rabbit-AF568 (1:250 for 45 minutes at room temperature ...
-
bioRxiv - Biophysics 2021Quote: ... The labeled protein concentration was measured using the Direct Detect spectrometer (Merck Millipore). The degree of labeling was calculated as the ratio of the dye concentration and the protein concentration ...
-
bioRxiv - Biophysics 2021Quote: ... Proteins were transferred onto an Immobilon FL PVDF membrane (Merck Millipore, Darmstadt, Germany), probed with antibodies ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein concentration of each lysate was determined using a BCA assay (Merck, 71285).
-
bioRxiv - Immunology 2021Quote: ... The deglycosylated protein was desalted and concentrated using Amicon filter (Merck Millipore, USA). The native protein and enzyme treated proteins were separated through SDS-PAGE and the proteins were transferred to the Nitrocellulose membrane using Trans-Blot Turbo Transfer System (Bio Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... The protein was concentrated using an Amicon Ultra 10 K device (Merck Millipore), loaded on a size exclusion column [ENrich SEC 650 10 x 300 Column (Bio-Rad)] ...
-
bioRxiv - Microbiology 2021Quote: ... Purified protein was further concentrated using Amicon Ultra Centrifugal Filter Units (Merck Millipore).
-
bioRxiv - Immunology 2021Quote: ... proteins were concentrated on a 0.5 mL 10 kDa filter (UFC501024, Merck-Millipore) by ultracentrifugation and purity was controlled by SDS-PAGE.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... proteins were electro-transferred to a polyvinylidene difluoride membrane (Merck Millipore, Darmstadt, Germany), which was incubated in the blocking buffer (5% non-fat milk ...
-
bioRxiv - Cell Biology 2020Quote: ... Immunoreactive proteins were visualized by Immobilion western chemiluminescence substrate (Merck-Millipore cat#WBKLS0500) [7].
-
bioRxiv - Cancer Biology 2020Quote: ... The protein fractions were isolated and concentrated using 3kDa centrifugal filters (Merck Millipore). LC MS/MS was performed on the concentrated culture CMed and spectral analysis was performed ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Total proteins were spotted (10 μg) onto nitrocellulose membranes (Merck Millipore, Darmstadt, Germany) and left to dry ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Total proteins were spotted (10 μg) onto nitrocellulose membranes (Merck Millipore, Darmstadt, Germany) and left to dry ...
-
bioRxiv - Immunology 2021Quote: 5 µl of 10 µm bead slurry (PureProteom Protein A magnetic beads, Merck) were used per reaction ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were concentrated to > 150 μM using centrifugal filters (Amicon Ultra; Merck Millipore), aliquoted and snap-frozen and stored at −80 °C ...