Labshake search
Citations for Merck :
801 - 850 of 2844 citations for Fc Receptor Like Protein 3 FCRL3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... 2-3 × 105 cells/well were plated in an ELI Spot plate (MAHAS4510, Merck Millipore, USA) and in vitro cultured for 18-24 hours in media supplemented with or without peptide at 0.5 µM (or ...
-
bioRxiv - Molecular Biology 2020Quote: The capped-RNA after nsp10-nsp16 reaction was digested using 3 U of Nuclease P1 (Merck) in 50 mM ammonium acetate buffer (pH 4.5 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE; Corden Pharma, Plankstadt Germany) and Cholesterol (Merck Millipore, Germany) by a thin-film method modified from previously described by Wui (Wui et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... then supernatant concentrated to 2 mL using 3 kDa Amicon Ultra-15 Centrifugal Filter Units (Merck). Supernatant was then washed 3 times with 15 mL 10 mM ammonium acetate to remove residual erythromycin ...
-
bioRxiv - Cell Biology 2021Quote: ... and were passed through a polycarbonate membrane filter with a 3-µm pore size (Merck Millipore). The supernatants (lysates ...
-
bioRxiv - Biochemistry 2020Quote: ... Prepared solutions were mixed at 3:1 ratio with 20% α-cyano-4-hydroxycinnamic acid (Merck) solution in 20% ACN ...
-
bioRxiv - Biochemistry 2021Quote: ... After binding beads were washed 3 times with binding buffer (PBS with protease inhibitor cocktail (Merck) and 1 mM Na3VO4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 µL of each methanolic extract were spotted on a HPTLC Silica Gel 60 plate (Merck). The mobile phase was composed of 50 % chloroform ...
-
bioRxiv - Immunology 2021Quote: ... Enriched HSPC-pDCs were then primed for 1-3 days in RF10 (RPMI-1640 medium (Merck) supplemented with 10% (v/v ...
-
bioRxiv - Cell Biology 2021Quote: ... for 10 min followed by 3 washes and incubation in media containing 100 μM thymidine (Merck). Before fixation ...
-
bioRxiv - Immunology 2021Quote: ... Excess of chelator was removed by ultrafiltration (Amicon Ultra 0.5 ml, 3 kDa MWCO, Merck Millipore) using the same buffer ...
-
Decoupling cell size homeostasis in diatoms from the geometrical constraints of the silica cell-wallbioRxiv - Microbiology 2023Quote: ... After 3 washes with deionized water (Milli-Q® IQ 7003 Ultrapure Lab Water System, Merck), the cells were dehydrated by washing in a graded series of ethanol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng G-CASE and 3 mL PEI solution (1 mg/mL) (Merck KGaA, Darmstadt, Germany). 100 µL transfected cells were seeded per well onto 96-well plates (Brand ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 3-(3,5-dioxo-1,2,4-oxadiazolidin-2-yl)-L-alanine (quisqualate) was purchased from Merck (Darmstadt, Germany). AF647-conjugated 9E10 antibody was prepared in-house as described previously (Cook et al. ...
-
bioRxiv - Immunology 2023Quote: ... Excess of chelator was removed by ultrafiltration (Amicon Ultra 0.5 ml, 3 kDa MWCO, Merck Millipore) using the same buffer conditions ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 mM DTT) using Amicon Ultra-15 3 K or 30 K centrifugation units (Merck Millipore). The phase separation assay was performed in the presence or absence of 10% polyethylene glycol 8000 (PEG-8000 ...
-
bioRxiv - Microbiology 2024Quote: ... The parasite solution was passed through a filter of 3 μm exclusion size (Merck-Millipore, TSTP04700) to remove host cell debris and collected in 15 ml conical tubes ...
-
bioRxiv - Microbiology 2024Quote: ... Supernatant was transferred to Amicon Ultra-0.5 Centrifugal Filter Unit 3 kDa (Merck Millipore cat # UFC500396) and centrifuged for 45 min at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... and the flow-through was concentrated using an Amicon Ultracentrifugal filter (3 kDa MWCO, Merck-Millipore) and further purified by gel filtration (HiLoad™ 16/600 Superdex™ 200 gp ...
-
bioRxiv - Immunology 2023Quote: ... Pepstatin A Methyl Ester (Pepstatin A, 516485) and MCC950 (256373-96-3) were purchased from Merck. Ultrapure™ DNase/RNase-Free Distilled Water (10977035 ...
-
bioRxiv - Bioengineering 2023Quote: Wild-type (WT/AB) embryos at 3 dpf were anaesthetised in 0.2 mg/ml MS222 (Merck) and mounted on 1.2 % w/v/ low-melting point agarose (Merck) ...
-
bioRxiv - Biochemistry 2022Quote: ... excess cisplatin and thiourea was removed by centrifugal filtration (Merck, Amicon® Ultra 3 kDa filters) at 14,000 rcf for 10 minutes at 4 °C ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... in absolute ethanol (Thermo-Fischer; order code AJA214-2.5LPL) and 3 mL of propionic acid (Merck, Pty Ltd. ...
-
bioRxiv - Microbiology 2022Quote: ... Supernatant was transferred to Amicon Ultra-0.5 Centrifugal Filter Unit 3 kDa (Merck Millipore cat # UFC500396) and centrifuged for 45 min at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... 3-10 mL of liquid culture was filtered through 0.2 um Polycarbonate (PC) membrane filters (Merck Millipore Ltd ...
-
bioRxiv - Cancer Biology 2023Quote: ... slides were blocked with 3% freshly made bovine serum albumin (BSA)/PBS buffer (Sigma-Aldrich/Merck). The antibody mix containing the individually diluted metal-conjugated antibodies in 0.5% BSA/PBS was applied to the slides ...
-
bioRxiv - Microbiology 2023Quote: ... We used sterile-filtered 3 % bovine serum albumin (BSA heat shock fraction, pH 7, > 98 %, Merck) in 1 × Pierce PBS buffer (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Bioengineering 2024Quote: ... We then dissolved 100 μmol of N-ethyl-N’-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC, Merck, E7750) in 1 mL of MES buffer and added it to the beaker ...
-
bioRxiv - Neuroscience 2024Quote: ... a group of approximately 50 flies in a training tube alternately received 3-octanol (3OCT; Merck) and 4-methylcyclohexanol (4MCH ...
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Bioengineering 2024Quote: ... and the elution fractions were concentrated with Amicon Ultra centrifugal filter units (3 kDa, UFC800324, Merck) to a concentration of 0.24 mg/mL (3.6 µM) ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by incubation with 200 µl of blocking solution [3% bovine serum albumin (BSA) (10735086001; Merck) in PBS-T at 37 °C for 1 h ...
-
bioRxiv - Cell Biology 2020Quote: ... The supernatant fraction was collected and incubated with S-protein beads (Merck) for 2 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... Proteins were concentrated by ultrafiltration using Amicon Ultra centrifugal filters (Merck Millipore) with 50 kDa cut off ...
-
bioRxiv - Developmental Biology 2020Quote: ... Protein was concentrated using an Amicon 10 kD filter column (Merck UFC801008D) and purity tested by SDS-PAGE.
-
bioRxiv - Molecular Biology 2021Quote: ... proteins were transferred from the gel to a PVDF membrane (Merck, IPFL00010) by semi-dry transfer with Trans-Blot Turbo Transfer System (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... anti-Ubiquitinylated proteins,clone FK2 (cat# 04-263, Merck Millipore; 1:1000). Ponceau solution was prepared with Ponceau BS (cat# B6008 ...
-
bioRxiv - Physiology 2020Quote: ... proteins were transferred to a PVDF membrane (Immobilon-P, Merck Millipore, IPVH00010) with 160 mA for 90 min ...
-
bioRxiv - Neuroscience 2020Quote: ... the protein solution was filtered through a 100 kDa filter (MERCK, MRCFOR100). The filtrate was transferred to a low-protein binding tube and 20 equivalents of dopamine (final concentration ...
-
bioRxiv - Biochemistry 2021Quote: ... All remaining protein constructs were cloned into the pET28b vector (Merck Millipore). Unless otherwise stated ...
-
bioRxiv - Biophysics 2021Quote: ... Separated proteins were transferred onto a PVDF membrane (IPVH00010, Immobilon-P; Merck) and incubated for 2hr with blocking buffer containing 5% Skimmed milk (70166 ...
-
bioRxiv - Plant Biology 2020Quote: ... Protein concentrations were measured using a Direct Detect® Infrared Spectrometer (Merck).
-
bioRxiv - Microbiology 2020Quote: Infected insect cells were disrupted with CytoBuster™ protein extraction reagent (Merck) and clarified by centrifugation at 4,300 × g for 20m before column loading ...
-
bioRxiv - Microbiology 2020Quote: ... Target proteins were visualized with Immobilon Western Chemiluminescent HRP Substrate (Merck Millipore).
-
bioRxiv - Microbiology 2020Quote: ... GST bound protein was then cleaved using biotinylated thrombin (Merck Millipore; 69672) according to the manufacturers instructions overnight at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... proteins were transferred onto the methanol-activated µm PVDF membrane (Merck #ISEQ85R) using 1X transfer buffer (2.5 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Cell Biology 2021Quote: The Magna RNA-binding protein immunoprecipitation kit (Merck Millipore, Billerica, MA, USA) was applied for the assay ...
-
bioRxiv - Biophysics 2020Quote: ... 100 μl of 10 μg/ml recombinant protein G (Merck, Darmstadt, Germany) was added and incubated for 30 minutes ...