Labshake search
Citations for Merck :
901 - 950 of 6058 citations for 2 5 Sulfanyl 4H 1 2 4 triazol 3 yl phenol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: After saponification with 2 mL 1M 95% ethanolic sodium hydroxide solution (Merck KGaA, Darmstadt, Germany) at 60°C for one hour ...
-
bioRxiv - Cancer Biology 2023Quote: ... femurs and tibias in FACS buffer (PBS supplemented with 2% fetal calf serum (FCS; Merck) and 2 mM EDTA (Merck) ...
-
bioRxiv - Genetics 2023Quote: ... was added to each along with a single sterile 2 mm glass bead (Merck, Germany) to each tube ...
-
bioRxiv - Biophysics 2023Quote: ... RNA from yeast diluted in PBS (0.7 and 2 mg/mL; Sigma-Aldrich, Merck #10109223001).
-
bioRxiv - Bioengineering 2023Quote: ... followed by incubation in 10 mL of 2 U/mL dispase solution (D4693; Merck KGaA) at 4 °C overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was loaded onto a 2 ml column containing Ni-NTA His·Bind resin (Merck). The column was first washed with a solution containing 20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Membrane fractions were buffer-exchanged to PBS with Amicon Ultra 2-mL filters (Merck Millipore) and purified via FPLC with a Ni2+ column (Thermofisher).
-
bioRxiv - Neuroscience 2024Quote: ... and 0.12 U/μL RNase Inhibitor) inside a 2 mL Sorenson Dolphin microcentrifuge tube (Merck). The mixture containing the nuclei (800 μL ...
-
bioRxiv - Genetics 2024Quote: ... 0.25 M Tris(2-carboxyethyl) phosphine and 0.8M chloroacetamide dissolved in purified MilliQ water (Merck)) ...
-
bioRxiv - Microbiology 2024Quote: ... colourimetric measurement via Nitrite Test MQuant™ 2-80 mg/l NO - test stripes (Merck) was used for the day-to-day analysis of the performance of the bioreactors and ability to sufficiently degrade influent nitrogen avoiding harmful nitrite poisoning ...
-
bioRxiv - Microbiology 2024Quote: ... to which 10 g/L of 1,3-di-n-butyl-2 thiourea (DBT) (Merck, 8.20423.0250) was added ...
-
bioRxiv - Microbiology 2024Quote: ... diluted in RPMI 1640 medium supplemented 2 g/L of NaHCO3 (Merck®, Burlington, MA) and 10% fetal bovine serum (Gibco® ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 mM of MgCl2) with one protease inhibitor cocktail tablet (Mini EDTA-free, Roche, Merck) per 10 ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Molecular Biology 2021Quote: ... mouse anti-pan- histone H11-4 (1:500; Merck, Cat#MAB3422) or chicken anti-GFP (1:500 ...
-
bioRxiv - Pathology 2023Quote: ... 1:1000 4-repeat tau (aa 275-291, 05-804, Merck); 1:500 3-repeat tau (aa 267-316 ...
-
bioRxiv - Cancer Biology 2024Quote: ... DSB were induced with 4-nitroquinoline 1-oxide (4NQO) (Sigma/Merck).
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM GSK-3 Inhibitor XVI (Merck, 361559) and 0.8 μM PD184352 (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Microbiology 2024Quote: ... hsa-miR-21-5p scramble microRNA mimic and a double-stranded small RNA oligonucleotide control (sequence: 5’- GGAACGCCAACCGAAGUCUA - 3’) (all from Merck) were added to achieve a final concentration of 250 nM on each well ...
-
bioRxiv - Biochemistry 2024Quote: Lipids (1 mg from the brain and 3–5 mg from the testis) were separated via TLC (Silica Gel 60 TLC plate, Merck) with methyl acetate/2-propanol/chloroform/methanol/0.25% calcium chloride in water (25:25:25:10:9 ...
-
bioRxiv - Immunology 2021Quote: ... Histone neutralisation experiments were performed via intraperitoneal injection with dialysed and combined a-Histone 3 and a-Histone 4 antibodies (Merck Millipore) or control polyclonal rabbit IgG (BioXCell) ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was then concentrated to 100-200 μL using centrifugal filter units with a 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) by centrifugation at 5000 g at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... the supernatant from late-log cultures was concentrated to <100 μL and washed (with 400 μL of ddH2O) in 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) using centrifugation at 5000 g ...
-
bioRxiv - Microbiology 2023Quote: ... or RPMI-1640 (10.4 g/L RPMI-1640 powder without phenol red (Merck KGaA, Darmstadt, Germany), 1.8% D-Glucose (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... samples maintained at 4°C were eluted through a ZIC-pHILIC column (5 μm, polymeric, 150 by 4.6 mm; SeQuant, Merck) by mobile phase A (20 mM ammonium carbonate ...
-
bioRxiv - Genomics 2024Quote: ... media was changed for 500 µL of DMEM +5% FBS +4 μg/mL of polybrene (Merck TR-1003-G). Lentiviruses were diluted to the desired MOI in 500 µL of DMEM +5% FBS and slowly added to each well ...
-
bioRxiv - Genetics 2024Quote: ... The harvested medium was then centrifuged at 1,300 rpm at 4 °C for 5 min to remove cells and then filtered by 0.45 μm filter (Merck) and the virus was collected and stored at -80 °C.
-
bioRxiv - Cell Biology 2020Quote: ... pDEST42-Ctdnep1_C-ter plasmid was transformed in Rosetta™ 2(DE3)pLysS Competent bacteria (Merck Millipore), Bacteria cultures (500 ml ...
-
bioRxiv - Cell Biology 2020Quote: A549 cells were treated with 2 ng/ml TGF-β1 (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) for 2 days in DMEM with 10% FBS on non-treated culture dish surfaces (31 ...
-
bioRxiv - Immunology 2020Quote: ... After each cycle the flow channels were regenerated for 10 seconds with 2 M NaCl (Merck) at 10 µL/min ...
-
bioRxiv - Bioengineering 2021Quote: ... with Pellicon 2 mini cassettes (300 kDa, 0.1 m2, BioMax polyethersulfone membrane with C-screen; Merck), as previously described (4) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were plated at a density of 100,000cm-2 in 96 well plates (Corning, MERCK UK), with wells previously coated for 24h with 20μg/ml FHL-1 ...
-
bioRxiv - Biophysics 2020Quote: ... for 2 hours at 37°C and purified using a Amicon 30 kDa MWCO filter (Merck). Deep Vent exo-DNA polymerase (NEB ...
-
bioRxiv - Immunology 2021Quote: ... The left lung was inflated with 0.6mL PBS/2% (w/v) low melting point agarose (Merck) in PBS ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated in serum-free MEM supplemented with 2 µg/mL TPCK-treated trypsin (Merck) for 2 days at 37 °C in 5 % CO2 ...
-
bioRxiv - Immunology 2020Quote: ... cells were resuspended at a concentration of 10×106/100μL in PBS containing 2% FCS (Merck). Staining for cell surface antigens was performed for 20 minutes at 4°C in the dark ...
-
bioRxiv - Bioengineering 2022Quote: ... and LX-2 cells were labeled with a PKH67 Green Fluorescent Cell Linker Kit (Merck, PKH67GL) according to the manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2022Quote: ... Purified cells were cultured into organoids and treated with 2 μg/ml doxycycline (DOX, Merck, D9891) and 10 μM trimethoprim (TMP ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Human Caco-2 colorectal adenocarcinoma cells (1.7×105 cells/cm2) were cultured in DMEM medium (Merck) containing 10% FCS at 37°C and 5% CO2 ...
-
bioRxiv - Biophysics 2023Quote: ... 2 mL of supernatant containing viral particles was harvested and filtered with 0.45 μm filter (Merck). Supernatant was immediately used for transduction or stored at -80°C in aliquots.
-
bioRxiv - Neuroscience 2023Quote: ... Non-adherent cell culture plates were prepared with poly(2-hydroxyethyl methacrylate) (poly-HEMA; P3932, Merck) coating ...
-
bioRxiv - Biochemistry 2023Quote: ... in 30% (2-Hydroxypropyl)-β-cyclodextrin (HPβCD) or Sulfobutylether-β-Cyclodextrin (SBEβCD) (Sigma Aldrich, Merck, Germany). When tumors reached a size of 60-100 mm3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... During day 13 to 15 they were treated with 2 pulses of 3μM CHIR99021 (Merck, 361571) to dorsalise the tissue ...
-
bioRxiv - Developmental Biology 2023Quote: ... 25 μl of 2 mg/ml of 5ʹ-nucleotidase (snake venom from Crotalus atrox; Merck KGaA) in 0.1 M Tris-HCl pH 8.0 were added ...