Labshake search
Citations for Merck :
751 - 800 of 6058 citations for 2 5 Sulfanyl 4H 1 2 4 triazol 3 yl phenol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... SFM was replaced with SFM containing 2 % bovine serum albumin (BSA) (Merck). To stimulate the βARs ...
-
bioRxiv - Molecular Biology 2024Quote: ... The second plaque slice was preserved in 2% PFA (8.18715.1000, Merck Millipore) and used for optical tissue clearing.
-
bioRxiv - Bioengineering 2023Quote: ... 2 dpf embryos were manually dechorionated and anesthetized with MS-222 (Merck). 4 nl of the sample were delivered into the common cardinal vein using microcapillaries (TW100-4 ...
-
bioRxiv - Genetics 2024Quote: ... Primary antibodies used were: rabbit polyclonal to Olig-2 (Merck Millipore, #AB9610) (dilution 1:500) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 100 µL of 2 mg/mL sulfo-sanpah (Sigma-Aldrich/Merck) was added only onto PAA gels ...
-
bioRxiv - Cell Biology 2023Quote: ... released for 2 h and treated with 100 ng/ml nocodazole (Merck) for 16 - 17 h ...
-
bioRxiv - Biochemistry 2023Quote: ... grids were washed with aqueous 2% w/vol uranyl acetate (Merck, France) and then dried with ashless filter paper (VWR ...
-
bioRxiv - Developmental Biology 2022Quote: ... samples were incubated in 2% uranyl acetate (Sigma-Aldrich, Merck, Darmstadt, Germany) for 90 minutes at RT on a specimen rotator ...
-
bioRxiv - Evolutionary Biology 2024Quote: Spermathecae samples were fixed in mixture of 2% paraformaldehyde (Merck, Darmstadt, Germany), 2% glutaraldehyde (Agar Scientific ...
-
bioRxiv - Microbiology 2024Quote: Collected bone marrow was homogenized in 2 ml sterile 0.9% saline (Merck), diluted ...
-
bioRxiv - Biochemistry 2024Quote: ... + 10% heat-inactivated Fetal Bovine Serum (Eurobio) + 2 mM L-Glutamine (Merck) + 1% Penicillin/Streptomycin ...
-
bioRxiv - Microbiology 2024Quote: ... anti-SARS-CoV-2-N mouse monoclonal antibody (ZMS1075; Merck, Darmstadt, Germany), anti-LAMP1 rabbit polyclonal antibody (9091T ...
-
bioRxiv - Molecular Biology 2024Quote: ... and carefully layered over 2 mL of 20% sucrose (Merck Millipore, USA) in polypropylene tubes (Beckman Coulter ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.4 mM L-phenylalanine (Merck/Sigma-Aldrich, CAS number : 63-91-2),0.4 mM L-proline (Merck/Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2024Quote: ... contrasted in 2 % (w/v) uranyl acetate (Sigma-Aldrich, Merck, Darmstadt, Germany) for 1.5 h at room temperature and washed once in distilled water followed by dehydration through a series of increasing ethanol concentrations (30% for 5 min ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μl of N,N,N’,N’-Tetramethylethylendiamine (TEMED, #612-103-00-3, Sigma-Aldrich now Merck) was added to 1 ml of the monomer solution ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-cathepsin B (Abcam, ab92955, 1:1,000 and Merck, Ab-3 1:100) and anti-β-actin mouse monoclonal antibody (Sigma-Aldrich ...
-
bioRxiv - Immunology 2024Quote: ... cells were treated for 4 h with 5 mg/ml Brefeldin A (Merck, Darmstadt, Germany) after 140 h incubation time ...
-
bioRxiv - Biochemistry 2021Quote: ... After adding 1 drop of bovine thrombin (Biomed, Lublin, Poland) to 2 drops of fibrinogen (1mg/ml; Sigma-Aldrich, St. Louis, MO; Merck KGaA) the cells were entrapped within the fibrin clots ...
-
bioRxiv - Cell Biology 2021Quote: ... ethanol and cut into 1–2 mm3 pieces and was cultured in Dulbecco’s modified Eagle medium (DMEM) (Sigma-Aldrich, Merck, Darmstadt, Germany) with 10% (v/v ...
-
bioRxiv - Cell Biology 2023Quote: ... post-fixed in cooled ethanol:acetic acid (2:1) and stained using a TUNEL kit (ApopTag® Fluorescein In Situ Apoptosis Detection Kit, Merck Millipore, #S7110) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Media was concentrated further to a final volume of 1-2 ml using 10 KDa Amicon spin filters (Merck Millipore, MA, USA) by centrifugation at 3,500 g ...
-
bioRxiv - Microbiology 2022Quote: ... Five duplicate plates were spread individually by six gradient diluted soil suspensions from 10−2 to 10−7 dilution on 1/10 TSA medium (Tryptic Soy Agar, Merck, Darmstadt, Germany) and incubated under both aerobic and anaerobic conditions at 28 °C for two weeks ...
-
bioRxiv - Molecular Biology 2023Quote: ... All samples were fixed 1:1 with 4% PFA (Merck, no. P6148) (final concentration 2% PFA ...
-
bioRxiv - Genomics 2022Quote: ... cells were passaged 1:3 using Accutase (Merck Millipore, #SCR005) in a single-cell suspension and seeded at 50000 cells/cm2 on 20 μg/ml laminin-coated 6-well plate ...
-
bioRxiv - Cell Biology 2024Quote: ... Total RNA was isolated using 1-bromo-3-chloropropane (Merck) and the Analytik Jena Kit (#845-KS-2040050) ...
-
bioRxiv - Microbiology 2020Quote: RNA was prepared using Guanidinium thiocyanate-phenol-chloroform extraction with Tri Reagent (Merck). Tissue was homogenized in 1 ml of Tri reagent and disrupted using 1.4mm zinc oxide beads in a bead beater and tissue debris removed by centrifugation ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Cell Biology 2022Quote: Depletion of Cav1 was achieved by RNAi using siRNAs with the following sequence: 5’ GCAUCAACUUGCAGAAAGA 3’ (Merck), and Control siRNA Luciferase ...
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% DMSO and 5% normal goat serum (Merck) for 1 h at RT and incubated overnight with primary antibodies ...
-
bioRxiv - Neuroscience 2023Quote: ... and the slices were placed on Millicell membranes (3–4 slices per membrane, 0,4 µm Millicell, Merck Millipore). Slices were cultured in DMEM/F-12 with GlutaMax ...
-
bioRxiv - Biophysics 2024Quote: ... The 1,2-Distearoyl-sn-glycero-3-phosphocholine (DSPC, CAS: 816-94-4) was sourced from Merck (Darmstadt, Germany). Cholesterol (Chol ...
-
bioRxiv - Plant Biology 2024Quote: ... or standards (gallic acid in the range of 0–80 µg ml-1) were mixed with 200 µl of 10% Folin-Ciocalteu’s phenol reagent (Sigma-Aldrich, Merck, Burlington MA, USA) and incubated at 25°C in the dark for 5 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were incubated overnight and were treated with 2 IU/ml hCG (Merck Sharp & Dohme B.V. ...
-
bioRxiv - Cell Biology 2022Quote: ... Snap-Streptavidin-WA (pETplasmid) was expressed in Rosettas 2 (DE3) pLysS (Merck, 71403). Culture was grown in TB medium supplemented with 30 μg/mL kanamycine and 34 μg/mL chloramphenicol ...
-
bioRxiv - Neuroscience 2021Quote: ... 2% B27 (v/v)) or BrightCellTM NEUMO photostable medium (1X NEUMO (Merck Millipore), 4% SOS ...
-
bioRxiv - Cell Biology 2021Quote: ... A dose of 300mg/1kg body weight of APAP (Merck, 103-90-2) was injected i.p at a concentration of 40mg/ml ...
-
bioRxiv - Microbiology 2020Quote: ... 2ml/well of overlay {MEM containing 2% FBS and 0.4% Tragacanth (Merck, Israel)} was added to each well and plates were incubated at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Erythrocytes were removed from peripheral blood by Dextran sedimentation (2 % in PBS; Merck) and ACK lysis buffer (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were grown in RPMI1640 supplemented with 2 mM glutamine (Merck, Darmstadt, Germany) and 10 % Fetal Bovine Serum (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... LB agar medium (Bacto) was prepared with 2% sodium carboxymethyl cellulose (CMC) (Merck) or 2% pectin (Agdia AG366 ...
-
bioRxiv - Plant Biology 2021Quote: ... 0.5 g 2-(N-morpholino)ethanesulfonic acid (ULTRON grade, Merck KGaA, Darmstadt, Germany), and 5 g Gelrite (Duchefa) ...
-
bioRxiv - Neuroscience 2023Quote: ... and human recombinant FGF-2 (10 ng/ml; Merck Millipore, Burlington, MA, USA) as mitogens ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were washed four times with PBS and lysed with 2% saponin (Merck) for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... they were supplemented with 2 µg/ml Hoechst 33342 (Merck, cat. No. B2261). All the antibodies used are listed in Supplemental Table S2 ...
-
bioRxiv - Neuroscience 2024Quote: ... iPSCs were seeded in poly-HEMA (poly-2-hydroxyethyl methacrylate)-coated dishes (Merck) for embryoid bodies (EBs ...
-
bioRxiv - Immunology 2023Quote: ... The cells were cultured in the presence of 2 µg/ml puromycin (Merck) until the mortality of non-infected cells reached 100% leaving cells transfected with shRNA alive ...