Labshake search
Citations for Merck :
851 - 900 of 6573 citations for 6 Methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... ParT (S48C)-His6 and ParT (Q271C)-His6 aliquots were supplemented with 1 mM tris (2-carboxyethyl) phosphine hydrochloride (Merck; cat# C4706) before flash-freezing in liquid nitrogen.
-
bioRxiv - Cancer Biology 2024Quote: ... 2 million cells per mL were suspended in 1 mL of a 1.2% sodium alginate solution (Merck, Saint-Quentin-Fallavier, France). Beads were formed by dripping the cell suspension into a sterile 100 mM CaCl₂ solution (VWR ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1 M 3-Isobutyl-1-methylxanthine (IBMX; Merck, 15679), 50 mM DAPT (Merck ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), and interleukin 1β (IL1β ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), interleukin 1β (IL1β ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:100 Phosphatase Inhibitor cocktail 3 (Merck, P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001)) ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3 µM IWR-1 (MERCK, Cat. no. 681669). Glasgow’s MEM (GMEM)-based (Gibco ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.1 M 3-Isobutyl-1-methylxanthine (IBMX; Merck, 15679), 50 mM DAPT (Merck ...
-
bioRxiv - Genomics 2021Quote: ... and gentisic acid (2,5-dihydroxybenzoic acid; Merck, Product Number: 841745) was performed in AT minimal medium (86 ...
-
bioRxiv - Molecular Biology 2024Quote: ... digested peptides were acidified by the addition of 5% (v/v) LC-MS grade Formid Acid (FA) (Merck, 5.33002.0050) and purified on C18 columns (Stagetips ...
-
bioRxiv - Biochemistry 2023Quote: ... was incubated in 5 mM Tris-HCl buffer (pH 7.5) containing each substrate (1% glucomannan, Neogen, MI, USA; 1% polygalacturonic acid, Neogen; 1% carboxymethyl cellulose, Merck; 1% soluble starch ...
-
bioRxiv - Biochemistry 2021Quote: ... Reactions were stopped at each time point using 4 N formic acid and analyzed by PEI-Cellulose-F TLC (Merck) developed in 0.4 M potassium phosphate buffer (pH 3.4) ...
-
bioRxiv - Neuroscience 2023Quote: ... before transcardially perfusing with 21-28 ml of ice-cold PBS and 4%PFA-0,12% picric acid (Merck, Søborg, Denmark). Spleens were excised and weighed ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluates 1-3 were mixed and concentrated with Amicon Ultra-15 (Merck Millipore, MWCO 3 K) to protein concentrations of 44–162 µM.
-
bioRxiv - Bioengineering 2021Quote: BCP and BG samples dehydrated and embedded in poly-methyl-methacrylate resin (Merck KGaA). Sections performed with Leica SP1600 microtome (Wetzlar ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Carbamate (aldicarb) and organophosphates (paraoxon-ethyl, paraoxon-methyl and DFP) were acquired from Merck and dissolved in 70% ethanol and 100% DMSO ...
-
bioRxiv - Microbiology 2023Quote: ... Trimethylsilyl methyl glycosides were obtained by derivatization with the reagent Sylon™ HTP (Merck) after methanolysis of the polysaccharide with 3 M HCl in methanol at 85°C for 16 h (69) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The final clarification was achieved in Methyl Salicylate (M6752, MERCK Sigma Aldrich, MA, USA), which also served as both a storage and mounting medium.
-
bioRxiv - Neuroscience 2024Quote: ... and derivatizing with twice the volume of N-methyl-N-trimethylsilyltrifluoroacetamid (MSTFA) (Merck, Germany) to yield trimethylsilylated analytes ...
-
bioRxiv - Cell Biology 2020Quote: ... Smad3 inhibitor SIS3 (used at 6 μM; 1009104-85-1, Merck-Calbiochem), the inhibitor of JNK activity SB600125 (used at 20 μM ...
-
bioRxiv - Microbiology 2020Quote: ... Formic acid (Merck) was added to end the reaction (5% v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... Trichloroacetic acid(Merck), Fetal Bovine Serum (Merck ...
-
bioRxiv - Immunology 2023Quote: ... with Ehrlich’s reagent (Sigma)/perchloric acid (Merck) and absorbance was measured at 557 nm ...
-
bioRxiv - Neuroscience 2021Quote: ... This was followed by a 3 h blocking step with 5 % NGS (G9023, Merck, Darmstadt Germany) in the respective washing buffer ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Developmental Biology 2023Quote: ... slides were incubated for 4 h at 4°C with DAPI (1 µg/mL, Merck) and the following secondary antibodies diluted in blocking buffer ...
-
bioRxiv - Bioengineering 2021Quote: ... and 2 mL of Naphthol-AS-MX ALP solution (855, Merck KGaA).
-
bioRxiv - Molecular Biology 2021Quote: ... grids were colored with aqueous 2% (w/v) uranyl acetate (Merck, France) and then dried with ashless filter paper (VWR ...
-
bioRxiv - Biochemistry 2020Quote: Escherichia coli strain BL21(DE3) Rosetta-2 pLysS (Novagen Merck, Darmstadt Germany) was transformed with pET28a-His6-CrTRXz and grown in 1 L of 2YT medium supplemented with kanamycin (50 µg.mL-1 ...
-
bioRxiv - Immunology 2021Quote: ... 2 was further separated on RP-C18 F254s preparative TLC plates (Merck) using a methanol-acetonitrile (1:1 ...
-
bioRxiv - Cell Biology 2020Quote: ... CDK1/2 inhibitor III (called ‘Cdk1/2i’ in this study, Merck 217714), CHIR-99041 (called ‘GSK3i1’ in this study ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies used were: rabbit polyclonal to Olig-2 (Merck Millipore, #AB9610) (dilution 1:500) ...
-
bioRxiv - Pathology 2021Quote: ... Mouse anti-E2F4 monoclonal antibody (mAb) clone LLF4-2 (MABE160; Merck Millipore) used at 1/400 for PLA ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.1 mM Na3VO4,0.2 μM microcystin-LR and 10 mM 2-chloroacetamide (Merck)) as described previously (15).
-
bioRxiv - Molecular Biology 2021Quote: ... grids were colored with aqueous 2% (w/v) uranyl acetate (Merck, France) and then dried with ashless filter paper (VWR ...
-
bioRxiv - Molecular Biology 2022Quote: ... purified HDRT was concentrated using Amicon Ultra-2 Centrifugal Filter Units (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were selected in puromycin (2.5 µg/mL; Merck 58-58-2) for 7 days.
-
bioRxiv - Neuroscience 2023Quote: ... and the nuclear stain Hoechst 33258 (2 ug/mL, Sigma-Aldrich, Merck) for 2 h at RT ...
-
bioRxiv - Physiology 2022Quote: ... SFM was replaced with SFM containing 2 % bovine serum albumin (BSA) (Merck). To stimulate the βARs ...
-
bioRxiv - Molecular Biology 2024Quote: ... The second plaque slice was preserved in 2% PFA (8.18715.1000, Merck Millipore) and used for optical tissue clearing.
-
bioRxiv - Bioengineering 2023Quote: ... 2 dpf embryos were manually dechorionated and anesthetized with MS-222 (Merck). 4 nl of the sample were delivered into the common cardinal vein using microcapillaries (TW100-4 ...
-
bioRxiv - Genetics 2024Quote: ... Primary antibodies used were: rabbit polyclonal to Olig-2 (Merck Millipore, #AB9610) (dilution 1:500) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 100 µL of 2 mg/mL sulfo-sanpah (Sigma-Aldrich/Merck) was added only onto PAA gels ...
-
bioRxiv - Cell Biology 2023Quote: ... released for 2 h and treated with 100 ng/ml nocodazole (Merck) for 16 - 17 h ...
-
bioRxiv - Biochemistry 2023Quote: ... grids were washed with aqueous 2% w/vol uranyl acetate (Merck, France) and then dried with ashless filter paper (VWR ...
-
bioRxiv - Developmental Biology 2022Quote: ... samples were incubated in 2% uranyl acetate (Sigma-Aldrich, Merck, Darmstadt, Germany) for 90 minutes at RT on a specimen rotator ...
-
bioRxiv - Evolutionary Biology 2024Quote: Spermathecae samples were fixed in mixture of 2% paraformaldehyde (Merck, Darmstadt, Germany), 2% glutaraldehyde (Agar Scientific ...