Labshake search
Citations for Merck :
1101 - 1150 of 6573 citations for 6 Methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Maize was cultured in ¼ Hoagland’s medium (Hoagland’s No. 2 Basal Salt Mixture, Sigma-Aldrich/Merck), pH adjusted to 5.6-5.8 with KOH ...
-
bioRxiv - Neuroscience 2022Quote: ... Two hundred microliters of medium containing 2 μM human insulin (Merck, Sigma-Aldrich Cat# I9278) or medium only was added to the thoraxes for 10 min (the final concentration of insulin was 1 μM) ...
-
bioRxiv - Microbiology 2023Quote: ... transepithelial electric resistance (TEER) measurements were performed using a Millicell ERS-2 Voltohmmeter (Merck-Millipore) equipped with an Ag/AgCl electrode (STX01 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and protein complex was eluted in lysis buffer 2 containing 2.5 mM D-desthiobiotin (Merck). Protein tags were removed by overnight cleavage with HRV 3C protease ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was loaded onto a 2 ml column containing Ni-NTA His·Bind resin (Merck). The column was first washed with a solution containing 20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Cancer Biology 2023Quote: Samples were prepared with hot reducing SDS sample buffer containing 2-mercaptoethanol (Merck, Darmstadt, Germany) and loaded onto a 15 % SDS polyacrylamide gel to separate the proteins according to their size ...
-
bioRxiv - Immunology 2022Quote: Nose and throat swabs were collected in 2 ml transport medium containing 15% sucrose (Merck), 2.5 µg/ml Amphotericin B ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 μl of terminated reaction mix were spotted onto polyethyl-enimine-cellulose plates (Merck, Germany). ATP and released phosphate were then separated chromatographically in a buffer of 0.5 M LiCl ...
-
bioRxiv - Microbiology 2023Quote: ... 300 μL of aqueous phase was added to 500 μL of 2-propanol (Merck, Germany) and kept overnight at −20°C for RNA precipitation ...
-
bioRxiv - Microbiology 2022Quote: ... After testing for SARS-CoV-2 by PCR test (COBAS 6800, Merck México, Mexico city), they were classified as positive (AP ...
-
bioRxiv - Cell Biology 2023Quote: After saponification with 2 mL 1M 95% ethanolic sodium hydroxide solution (Merck KGaA, Darmstadt, Germany) at 60°C for one hour ...
-
bioRxiv - Cancer Biology 2023Quote: ... femurs and tibias in FACS buffer (PBS supplemented with 2% fetal calf serum (FCS; Merck) and 2 mM EDTA (Merck) ...
-
bioRxiv - Genetics 2023Quote: ... was added to each along with a single sterile 2 mm glass bead (Merck, Germany) to each tube ...
-
bioRxiv - Neuroscience 2024Quote: ... and 0.12 U/μL RNase Inhibitor) inside a 2 mL Sorenson Dolphin microcentrifuge tube (Merck). The mixture containing the nuclei (800 μL ...
-
bioRxiv - Microbiology 2024Quote: ... diluted in RPMI 1640 medium supplemented 2 g/L of NaHCO3 (Merck®, Burlington, MA) and 10% fetal bovine serum (Gibco® ...
-
bioRxiv - Genetics 2024Quote: ... 0.25 M Tris(2-carboxyethyl) phosphine and 0.8M chloroacetamide dissolved in purified MilliQ water (Merck)) ...
-
bioRxiv - Microbiology 2024Quote: ... to which 10 g/L of 1,3-di-n-butyl-2 thiourea (DBT) (Merck, 8.20423.0250) was added ...
-
bioRxiv - Molecular Biology 2024Quote: ... Membrane fractions were buffer-exchanged to PBS with Amicon Ultra 2-mL filters (Merck Millipore) and purified via FPLC with a Ni2+ column (Thermofisher).
-
bioRxiv - Microbiology 2024Quote: ... colourimetric measurement via Nitrite Test MQuant™ 2-80 mg/l NO - test stripes (Merck) was used for the day-to-day analysis of the performance of the bioreactors and ability to sufficiently degrade influent nitrogen avoiding harmful nitrite poisoning ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 mM of MgCl2) with one protease inhibitor cocktail tablet (Mini EDTA-free, Roche, Merck) per 10 ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Plant Biology 2023Quote: ... Acid digestion was performed by adding 9 mL of 69% nitric acid (HNO3) (Suprapur, Merck) and 1 mL of 30% hydrogen peroxide (H2O2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... mouse anti-pan- histone H11-4 (1:500; Merck, Cat#MAB3422) or chicken anti-GFP (1:500 ...
-
bioRxiv - Pathology 2023Quote: ... 1:1000 4-repeat tau (aa 275-291, 05-804, Merck); 1:500 3-repeat tau (aa 267-316 ...
-
bioRxiv - Cancer Biology 2024Quote: ... DSB were induced with 4-nitroquinoline 1-oxide (4NQO) (Sigma/Merck).
-
bioRxiv - Immunology 2023Quote: ... Bacterial cells processed via ultrasound and insoluble inclusion bodies were extracted with 1% deoxycholic acid (Merck) and 1% Triton X-100 (Merck ...
-
bioRxiv - Physiology 2024Quote: ... followed by 1% acetic acid for 30 seconds and Safranin’O solution for 45 min (S2255, Merck).
-
bioRxiv - Neuroscience 2023Quote: ... 10-15 neurospheres and 4-6 organoids per cell line were rinsed twice with PBS and then lysed in RIPA buffer (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) supplemented with Protease Inhibitor Cocktail and Phosphatase Inhibitor Cocktail (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM GSK-3 Inhibitor XVI (Merck, 361559) and 0.8 μM PD184352 (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Microbiology 2024Quote: ... hsa-miR-21-5p scramble microRNA mimic and a double-stranded small RNA oligonucleotide control (sequence: 5’- GGAACGCCAACCGAAGUCUA - 3’) (all from Merck) were added to achieve a final concentration of 250 nM on each well ...
-
bioRxiv - Biochemistry 2024Quote: Lipids (1 mg from the brain and 3–5 mg from the testis) were separated via TLC (Silica Gel 60 TLC plate, Merck) with methyl acetate/2-propanol/chloroform/methanol/0.25% calcium chloride in water (25:25:25:10:9 ...
-
bioRxiv - Cancer Biology 2021Quote: ... α6-integrin (Merck, monoclonal, MAB1378), Laminin V (Merck ...
-
bioRxiv - Developmental Biology 2023Quote: ... 6% PEG 4000 (Merck-Schuchardt), pH 5.0 ...
-
bioRxiv - Immunology 2021Quote: ... Histone neutralisation experiments were performed via intraperitoneal injection with dialysed and combined a-Histone 3 and a-Histone 4 antibodies (Merck Millipore) or control polyclonal rabbit IgG (BioXCell) ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was then concentrated to 100-200 μL using centrifugal filter units with a 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) by centrifugation at 5000 g at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... the supernatant from late-log cultures was concentrated to <100 μL and washed (with 400 μL of ddH2O) in 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) using centrifugation at 5000 g ...
-
bioRxiv - Microbiology 2024Quote: ... samples maintained at 4°C were eluted through a ZIC-pHILIC column (5 μm, polymeric, 150 by 4.6 mm; SeQuant, Merck) by mobile phase A (20 mM ammonium carbonate ...
-
bioRxiv - Genomics 2024Quote: ... media was changed for 500 µL of DMEM +5% FBS +4 μg/mL of polybrene (Merck TR-1003-G). Lentiviruses were diluted to the desired MOI in 500 µL of DMEM +5% FBS and slowly added to each well ...
-
bioRxiv - Genetics 2024Quote: ... The harvested medium was then centrifuged at 1,300 rpm at 4 °C for 5 min to remove cells and then filtered by 0.45 μm filter (Merck) and the virus was collected and stored at -80 °C.
-
bioRxiv - Molecular Biology 2024Quote: 6 mL bone extraction buffer (1 M Trizma base, 0.1 M NaCl, 50 mM TitriplexIII (Merck), 0.5% SDS (Life Technologies ...
-
bioRxiv - Biochemistry 2024Quote: ... Ultrapure nitric acid was produced in-house from trace analysis grade nitric acid (Merck, Darmstadt, Germany) using a SubPur quartz sub-boiling distillation system (Milestone ...
-
bioRxiv - Cell Biology 2020Quote: ... pDEST42-Ctdnep1_C-ter plasmid was transformed in Rosetta™ 2(DE3)pLysS Competent bacteria (Merck Millipore), Bacteria cultures (500 ml ...
-
bioRxiv - Cell Biology 2020Quote: A549 cells were treated with 2 ng/ml TGF-β1 (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) for 2 days in DMEM with 10% FBS on non-treated culture dish surfaces (31 ...
-
bioRxiv - Immunology 2020Quote: ... After each cycle the flow channels were regenerated for 10 seconds with 2 M NaCl (Merck) at 10 µL/min ...