Labshake search
Citations for Merck :
801 - 850 of 5379 citations for 6 propan 2 yl 1 3 5 triazine 2 4 diamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was loaded onto a 2 ml column containing Ni-NTA His·Bind resin (Merck). The column was first washed with a solution containing 20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and protein complex was eluted in lysis buffer 2 containing 2.5 mM D-desthiobiotin (Merck). Protein tags were removed by overnight cleavage with HRV 3C protease ...
-
bioRxiv - Microbiology 2023Quote: ... transepithelial electric resistance (TEER) measurements were performed using a Millicell ERS-2 Voltohmmeter (Merck-Millipore) equipped with an Ag/AgCl electrode (STX01 ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Molecular Biology 2021Quote: ... mouse anti-pan- histone H11-4 (1:500; Merck, Cat#MAB3422) or chicken anti-GFP (1:500 ...
-
bioRxiv - Pathology 2023Quote: ... 1:1000 4-repeat tau (aa 275-291, 05-804, Merck); 1:500 3-repeat tau (aa 267-316 ...
-
bioRxiv - Neuroscience 2023Quote: ... 10-15 neurospheres and 4-6 organoids per cell line were rinsed twice with PBS and then lysed in RIPA buffer (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) supplemented with Protease Inhibitor Cocktail and Phosphatase Inhibitor Cocktail (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Immunology 2021Quote: ... Histone neutralisation experiments were performed via intraperitoneal injection with dialysed and combined a-Histone 3 and a-Histone 4 antibodies (Merck Millipore) or control polyclonal rabbit IgG (BioXCell) ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was then concentrated to 100-200 μL using centrifugal filter units with a 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) by centrifugation at 5000 g at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... the supernatant from late-log cultures was concentrated to <100 μL and washed (with 400 μL of ddH2O) in 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) using centrifugation at 5000 g ...
-
bioRxiv - Cancer Biology 2021Quote: ... α6-integrin (Merck, monoclonal, MAB1378), Laminin V (Merck ...
-
bioRxiv - Developmental Biology 2023Quote: ... 6% PEG 4000 (Merck-Schuchardt), pH 5.0 ...
-
bioRxiv - Microbiology 2024Quote: ... samples maintained at 4°C were eluted through a ZIC-pHILIC column (5 μm, polymeric, 150 by 4.6 mm; SeQuant, Merck) by mobile phase A (20 mM ammonium carbonate ...
-
bioRxiv - Genomics 2024Quote: ... media was changed for 500 µL of DMEM +5% FBS +4 μg/mL of polybrene (Merck TR-1003-G). Lentiviruses were diluted to the desired MOI in 500 µL of DMEM +5% FBS and slowly added to each well ...
-
bioRxiv - Molecular Biology 2024Quote: 6 mL bone extraction buffer (1 M Trizma base, 0.1 M NaCl, 50 mM TitriplexIII (Merck), 0.5% SDS (Life Technologies ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... or 1-octanol was used (1-OCT; CAS: 111-87-5; Merck, Darmstadt, Germany; undiluted). Paraffin is without behavioural significance in larval Drosophila (Saumweber et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... Slides were mounted using a 3:1 solution of Canada balsam (Merck, # 1016910100) and Histoclear (HS-202 HISTO-CLEAR II ...
-
bioRxiv - Cell Biology 2020Quote: ... or rabbit anti-p34-Arc/ARPC2 (Arp2/3, 1:100, Merck, 07-227). This was followed by incubation with appropriate Alexa Fluor-conjugated secondary antibodies (1:500 ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 mM DTT) and concentrated using a 3 kD MWCO centricon (Merck Millipore). For best performance in the iSAT reaction ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... namely using 1 g/L MS-222 (Ethyl 3-aminobenzoate methanesulfonate, Merck #E10521) and subsequent exsanguination by cutting the gill arches ...
-
bioRxiv - Cell Biology 2020Quote: ... pDEST42-Ctdnep1_C-ter plasmid was transformed in Rosetta™ 2(DE3)pLysS Competent bacteria (Merck Millipore), Bacteria cultures (500 ml ...
-
bioRxiv - Cell Biology 2020Quote: A549 cells were treated with 2 ng/ml TGF-β1 (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) for 2 days in DMEM with 10% FBS on non-treated culture dish surfaces (31 ...
-
bioRxiv - Immunology 2020Quote: ... After each cycle the flow channels were regenerated for 10 seconds with 2 M NaCl (Merck) at 10 µL/min ...
-
bioRxiv - Bioengineering 2021Quote: ... with Pellicon 2 mini cassettes (300 kDa, 0.1 m2, BioMax polyethersulfone membrane with C-screen; Merck), as previously described (4) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were plated at a density of 100,000cm-2 in 96 well plates (Corning, MERCK UK), with wells previously coated for 24h with 20μg/ml FHL-1 ...
-
bioRxiv - Biophysics 2020Quote: ... for 2 hours at 37°C and purified using a Amicon 30 kDa MWCO filter (Merck). Deep Vent exo-DNA polymerase (NEB ...
-
bioRxiv - Biochemistry 2019Quote: ... 2 µl were spotted onto a thin layer chromatography (TLC) plate (PEI Cellulose F; Merck Millipore) pre-spotted with 2 µl of nucleotide mix containing AMP ...
-
bioRxiv - Biochemistry 2019Quote: All proteins were expressed in E.coli Rosetta-2 DE3 cells (EMD Millipore, Merck KGaA, Darmstadt, Germany). Cells were transformed via heat shock (42°C for 35 secs ...
-
bioRxiv - Immunology 2021Quote: ... The left lung was inflated with 0.6mL PBS/2% (w/v) low melting point agarose (Merck) in PBS ...
-
bioRxiv - Cell Biology 2019Quote: ... the membranes were blocked with 2% BSA in PBS with 0.1% Tween-20 (Merck; blocking buffer) and incubated with primary antibodies diluted in blocking buffer overnight at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated in serum-free MEM supplemented with 2 µg/mL TPCK-treated trypsin (Merck) for 2 days at 37 °C in 5 % CO2 ...
-
bioRxiv - Immunology 2020Quote: ... cells were resuspended at a concentration of 10×106/100μL in PBS containing 2% FCS (Merck). Staining for cell surface antigens was performed for 20 minutes at 4°C in the dark ...
-
bioRxiv - Bioengineering 2022Quote: ... and LX-2 cells were labeled with a PKH67 Green Fluorescent Cell Linker Kit (Merck, PKH67GL) according to the manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2022Quote: ... Purified cells were cultured into organoids and treated with 2 μg/ml doxycycline (DOX, Merck, D9891) and 10 μM trimethoprim (TMP ...
-
bioRxiv - Neuroscience 2023Quote: ... Non-adherent cell culture plates were prepared with poly(2-hydroxyethyl methacrylate) (poly-HEMA; P3932, Merck) coating ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells have been lysed using 2× Laemmli buffer supplied with 100mM DTT (Dithiothreitol, Merck Sigma Aldrich), boiled at 95°C for 10min and then DNA was sheared by sonication (Bioruptor® Pico ...
-
bioRxiv - Biochemistry 2023Quote: ... in 30% (2-Hydroxypropyl)-β-cyclodextrin (HPβCD) or Sulfobutylether-β-Cyclodextrin (SBEβCD) (Sigma Aldrich, Merck, Germany). When tumors reached a size of 60-100 mm3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... During day 13 to 15 they were treated with 2 pulses of 3μM CHIR99021 (Merck, 361571) to dorsalise the tissue ...
-
bioRxiv - Developmental Biology 2023Quote: ... 25 μl of 2 mg/ml of 5ʹ-nucleotidase (snake venom from Crotalus atrox; Merck KGaA) in 0.1 M Tris-HCl pH 8.0 were added ...
-
bioRxiv - Physiology 2023Quote: ... an amount of 2 g/kg body weight D-glucose (20% solution in PBS+/+, Merck, USA) was injected ...
-
bioRxiv - Biophysics 2023Quote: ... 2 mL of supernatant containing viral particles was harvested and filtered with 0.45 μm filter (Merck). Supernatant was immediately used for transduction or stored at -80°C in aliquots.
-
bioRxiv - Molecular Biology 2023Quote: pCold-DDX43 and pCold-DDX6 were transformed into Rosetta 2 (DE3) competent cells (Merck Millipore/Novagen). The cells were cultured at 37°C until the OD600 reached ∼0.6 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Human Caco-2 colorectal adenocarcinoma cells (1.7×105 cells/cm2) were cultured in DMEM medium (Merck) containing 10% FCS at 37°C and 5% CO2 ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were starved overnight in serum-free DMEM and then treated for 1 hour with 5 ng/ml TGFβ1 (Preprotech) or with 5 μM SB431542 (Merck), and intensities quantified by ImageJ ...