Labshake search
Citations for Merck :
801 - 850 of 2466 citations for 5 Bromobenzothiazole 2 sulfonic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and host plants was assessed by extracting the compounds following [6] by immersing the samples for 5 min in 5 ml of hexane (99%, SupraSolv, Merck, Germany), followed by removal from hexane with entomological tweezers that were previously cleaned with hexane ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Immunology 2024Quote: ... the MFI-value was converted to ng/mL by interpolation from a 5-parameter logistic (5-PL) curve of reference standard using the MILLIPLEX® Analyst 5.1 software (The Life Science/Merck KGaA).
-
bioRxiv - Cancer Biology 2024Quote: ... and non-specific binding was blocked with 5% milk powder or 5% bovine serum albumin (BSA) in tris-buffered saline containing 0.05% Tween-20 (Merck, Darmstadt, Germany). Blots were incubated overnight with mouse anti-gp130 (R&D systems ...
-
bioRxiv - Microbiology 2020Quote: ... TarP or TarM (6.3 μg/ml) for 2 hours at room temperature with UDP-GlcNAc (2 mM, Merck) in glycosylation buffer (15 mM HEPES ...
-
Microbial iCLIP2: Enhanced mapping of RNA-Protein interaction by promoting protein and RNA stabilitybioRxiv - Molecular Biology 2024Quote: ... 1% IGEPAL CA-630, 0.1% SDS, 0.5% sodium deoxycholate, 2 M urea, 2× Complete protease inhibitor EDTA-free [Merck, 11873580001] ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-Sox9 (Merck, AB5535; 2 μg/ml); anti-Tfap2a (DSHB ...
-
bioRxiv - Developmental Biology 2021Quote: ... containing 2 mM calcium chloride (Merck, C27902) overnight at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... staining with 2% uranyl acetate (Merck KGaA) overnight in water ...
-
bioRxiv - Cell Biology 2022Quote: ... rat anti-tyrosinated tubulin (YL1/2, Merck), mouse anti-acetylated tubulin (T6793 ...
-
bioRxiv - Immunology 2021Quote: ... and 2 µg/mL TPCK trypsin (Merck). The pfu were counted following staining with 1 % (w/v ...
-
bioRxiv - Immunology 2021Quote: ... with 10 uL/mL 2-ME (Merck) after which RNA was isolated using RNeasy Microprep ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 2 µL 250 U/µL Benzonase (Merck) and 20 mM lysozyme were added into a 40 mL cell solution and kept on ice for one hour ...
-
bioRxiv - Genomics 2022Quote: ... and 2 kU/mL DNase I (Merck)] at 37 °C for 60 minutes ...
-
bioRxiv - Genomics 2022Quote: ... and 2 kU/mL DNase I (Merck)] at 37 °C for 60 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 294 mg/L CaCl2(H2O)2 (Merck), 294 mg/L MgCl2(H2O)6 (Merck) ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 2% sucrose (Merck KGaA; type number: 107687), and three drops of fresh yeast ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 U/mL PK-LD (Merck #P0294), 2 mM GlcNAc and 1 mM ATP ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2 mM PMSF (Merck Life Sciences) and thawed for 30 minutes on ice ...
-
bioRxiv - Microbiology 2022Quote: ... 1x phosphatase inhibitor cocktail 2 (P5726, Merck), 1x cOmplete protease inhibitor (REF) ...
-
bioRxiv - Developmental Biology 2022Quote: ... containing 2 mM calcium chloride (Merck, C27902) overnight at 4°C ...
-
bioRxiv - Plant Biology 2024Quote: ... E.coli Rosetta 2 (DE3) (Merck, Darmstadt, Germany) cells harboring the plasmid p2CT-His-MBP-Lbu_C2c2_WT (Addgene No ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 2 µM Thiazovivin (Merck Millipore) on the first day after passaging with daily medium change for at least ten passages before being used for molecular karyotyping ...
-
bioRxiv - Immunology 2023Quote: ... coli Rosetta 2 (DE3) BL21 cells (Merck). Transformed bacteria were inoculated in 2× Yeast Extract Tryptone (2YT ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2 mM L-glutamine (Merck, #G7513) in a humidified incubator with 5% CO2 at 37 °C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2% (w/v) peptone (Merck, Millipore®), 2% (w/v ...
-
bioRxiv - Cancer Biology 2023Quote: Two different siRNAs (Merck, Supplementary Table 2) that target constitutive exons with minimum predicted off-targets were designed and pooled together ...
-
bioRxiv - Genetics 2023Quote: ... and 2% Protease Inhibitor Cocktail from Merck) were lysed with 0.5 mm Zirconia/Silica Beads in a FastPrep-24TM homogenizer ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2 µL Benzonase (Sigma/Merck # E1014)] ...
-
bioRxiv - Immunology 2023Quote: ... containing 10 µg/mL 2-mercaptoethanol (Merck). For increasing bacterial dose analysis ...
-
bioRxiv - Genetics 2023Quote: ... 0.1 mM 2-mercaptoethanol (#M6250; Merck KGaA), and ESGRO-2i Supplement Kit (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... and MLi-2 from Merck (Tocris #5756) were used for these experiments as TLR2 inflammatory stimuli and LRRK2 kinase inhibitor respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... 2-deoxyglucose (2DG; catalogue # D8375-5G, Merck Life Sciences UK ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 μM propidium iodide (PI; Merck, Germany) for dead cell staining ...
-
bioRxiv - Microbiology 2024Quote: ... or Mowiol (SARS-CoV-2, Merck/Calbiochem). All the incubations and washing steps were performed under soft rocking for better results ...
-
bioRxiv - Cell Biology 2024Quote: ... and using 2-propanol and ethanol (Merck) to precipitate the DNA ...
-
bioRxiv - Immunology 2024Quote: ... with 10 uL/mL 2-ME (Merck) after which RNA was isolated using RNeasy Microprep ...
-
bioRxiv - Microbiology 2024Quote: ... or with 2 µM Pyrimethamine (PYR, Merck) 2 h post transfection respectively ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse MAG antibody (2 μg/ml, Merck), rabbit Olig2 antibody (2 μg/ml ...
-
bioRxiv - Immunology 2024Quote: ... with 10 uL/mL 2-ME (Merck) after which RNA was isolated using RNeasy Microprep ...
-
bioRxiv - Microbiology 2024Quote: ... 294 mg/L CaCl2(H2O)2 (Merck), 294 mg/L MgCl2(H2O)6 (Merck) ...
-
bioRxiv - Plant Biology 2024Quote: ... 2 Basal Salt Mixture (H2395-10L, Merck) was mixed with MQ water to create a 0.85X solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM L-Glutamine (Merck, cat. #G7513)) and incubated at 37°C 5% CO2 overnight ...
-
bioRxiv - Immunology 2024Quote: ... and 2 mM EDTA (Merck-Sigma, USA)) and analyzed by flow cytometry using a 3-laser Gallios flow cytometer (Beckman Coulter ...
-
bioRxiv - Biochemistry 2024Quote: SDC-XY: 2% (w/v) glucose (Merck), 0.67% (w/v ...
-
bioRxiv - Neuroscience 2020Quote: ... fillet dissections of L3 larvae or pharate adults were performed in modified HL3 solution ([HL3-EGTA] 70 mM NaCl, 5 mM KCl, 10 mM NaHCO3, 20 mM MgCl2, 5 mM trehalose (Merck KGaA, 108216), 115 mM sucrose (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... The extracted 212Pb in 0.1 M HCl obtained from the emanation generator was adjusted to pH 5-6 with 5 M sodium acetate (Merck, Darmstadt, Germany) and mixed with TCMC-mAbs with specific activities of 1-50 MBq/mg ...
-
bioRxiv - Molecular Biology 2021Quote: Transfected HEK293T cells were treated for 16 h with DMSO or with 10 µM Cyclopiazonic acid (CPA, Merck) before collection.
-
bioRxiv - Microbiology 2020Quote: ... Organic acids (lactate, acetate, pyruvate and succinate) were analyzed using a reversed-phased HPLC (Merck-Hitachi, Darmstadt, Germany) equipped with a diode array detector (L-7450 ...