Labshake search
Citations for Merck :
751 - 800 of 2466 citations for 5 Bromobenzothiazole 2 sulfonic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2023Quote: ... 95% and 100% ethanol solutions (5 min each) and subsequently washed twice in xylol (5 min each) and embed using Eukitt (#03989, Merck).
-
bioRxiv - Microbiology 2024Quote: ... 5 mM DTT and 5%(v/v) glycerol by five cycles of filtration through 10 kDa Amicon filters (Merck Millipore), and finally concentrated to 0.5 mg/ml.
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Bioengineering 2023Quote: ... 30 mL Expi293 cultures were transfected with HER2 expression plasmid and the supernatant harvested 5-7 days later via centrifugation at 300 G for 5 minutes followed by filtration (Steriflip 0.22mm Merck, SCGP00525). HER2 was then purified from supernatant as previously described (Vazquez-Lombardi et al. ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Plant Biology 2024Quote: ... The extracts were spotted on a 5 cm x 5 cm TLC Silica gel 60 F₂₅₄ plate (Merck, Darmstadt, Germany). The blots were stained by spraying with a methanolic solution including 1% diphenylboric acid 2- aminoethylester (DPBA ...
-
bioRxiv - Genetics 2024Quote: ... 90%, 100% ethanol, 5 min each), cleared in xylene (twice, 5 min each) and mounted with DPX mounting medium (Merck).
-
bioRxiv - Microbiology 2022Quote: ... was prepared using 5× M9 minimal salts (Merck), diluted as appropriate ...
-
bioRxiv - Immunology 2020Quote: ... 0.1 mg/mL 3,5,3’,5’-tetramethylbenzidine (TMB, Merck) and 0.003% (v/v ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg H3K27me3 antibody (17-622, Merck-Millipore). For quantitative comparison of CTCF binding between WT and CTCF-AID cells ...
-
bioRxiv - Biochemistry 2020Quote: ... PBST/5% milk powder or ChemiBLOCKER (Merck KGaA). After further washing ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4NQO (CAS: 56-57-5) was from Merck Life Science (Espoo ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-HT (Serotonin creatinine sulfate monohydrate, H7752, Merck), m-CPBG (1-(3-Chlorophenyl)biguanide hydrochloride ...
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 5 µg/ml insulin (Merck, I5500), 1.8×10-4 M adenine (Merck ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5 µg/ml Apo-Transferrine (Merck, T2036). Explants were removed after 7 days once half of the membrane had been covered with keratinocytes and the culture was maintained by changing media every three days ...
-
bioRxiv - Immunology 2022Quote: ... 5 - 15 mM PEG-3000 (Sigma and Merck), 20 - 30 µM CA-074Me (Calbiochem) ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Biophysics 2022Quote: ... using spin filters (Merck, Millipore, MWCO: 5 kDa).
-
bioRxiv - Neuroscience 2020Quote: ... 5% aluminum sulfate solution (Merck Millipore, ref. 1.00121) for 5 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked with 5% BSA (Merck KGaA) in TBS (Merck KGaA ...
-
bioRxiv - Biochemistry 2020Quote: ... Slides were later stained with 5% Giemsa (Merck) for 4 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... supplemented with benzonase (5 μL/g pellet, Merck) and incubated for 15 min on a shaking table ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were suspended in 5% BSA (Merck; #12659) in PBS and single cells were sorted using a BD FACSJazz system into wells of a 96-well cell culture plate ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescein-labelled ssDNA substrate (5’[FAM]-pT50; Merck) was used in all SEC experiments to allow us to characterise complexes formed on DNA in the absence of any unwinding.
-
bioRxiv - Cell Biology 2024Quote: ... 5 µg/ml holo-transferrin (Merck, cat. #T0665), 5 ng/ml EGF (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% DMSO and 5% normal goat serum (Merck) for 1 h at RT and incubated overnight with primary antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 5 % heat-inactivated horse serum (Merck), EGF (20 ng mL−1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and/or 5 μg/ml 17β-Estradiol (Merck). At least 3 independent experiments with at least 2 independent littermate MEF clones of each genotype and each sex were performed to measure DNA damage responses ...
-
bioRxiv - Biochemistry 2024Quote: ... Blocking with 5% bovine serum albumin (Merck, 126575) was used for rabbit anti-LC3B-I/II (1:3000 ...
-
bioRxiv - Systems Biology 2024Quote: ... (5) Pronase (Merck, CAS-No 9036-06-0) at a concentration of 1:100 in E3 1x medium is added at 20 hpf to remove the chorion [83] ...
-
bioRxiv - Plant Biology 2020Quote: Inflorescences were harvested into fresh fixative (3:1 96% [v/v] ethanol [Merck] and glacial acetic acid) and kept overnight (O/N ...
-
bioRxiv - Cell Biology 2022Quote: ... Lipid extracts were pooled and an aliquot of samples and standard mix (triolein:diolein:monoolein:oleic acid) were applied to a silica 60 thin-layer chromatography plate (1.05553.0001, Merck, Darmstadt, Germany) using hexane:diethylether:acetic acid (70:29:1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and functionalized by 200 µl of a 3% (v/v) solution of hyaluronic acid (HA) (Merck, Germany) at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mobile phase consisted of (A) 0.1% formic acid in MQ H2O (Merck Millipore, Bedford, MA, USA) and (B ...
-
bioRxiv - Immunology 2020Quote: ... MHC–peptide complexes were eluted by repeated addition of 0.2% trifluoroacetic acid (TFA, Merck, Whitehouse Station, NJ). Peptides were purified by ultrafiltration using centrifugal filter units (Amicon ...
-
bioRxiv - Immunology 2022Quote: ... ATP and Poly(deoxyadenylic-thymidylic) acid sodium salt (Poly dA-dT) were obtained from Merck (Darmstadt, Germany). Val-boroPro - Calbiochem 5314650001 was obtained from Merck (Darmstadt ...
-
bioRxiv - Cell Biology 2023Quote: ... Depletion of Top2α was achieved by addition of 500μM of indole acetic acid (IAA) (Merck; I5148-2G) for 1h ...
-
bioRxiv - Cell Biology 2023Quote: ... Incubations were terminated after 90 mins by the addition of 0.2 ml 20% perchloric acid (Merck Millipore) and ...
-
bioRxiv - Genetics 2024Quote: ... For PAS staining the sections were stained with 0,9 % periodic acid (cat# 3257.1, Roth) and Schiffsches Reagent (cat#1.09033, Merck) both for 10 min embedded into washing steps with H2O ...
-
bioRxiv - Neuroscience 2024Quote: ... Neurons were maintained in Neurobasal/B27 supplemented with 20 ng/ml L-ascorbic acid (Merck Life Sciences), 20 ng/ml BDNF (PreproTech ...
-
bioRxiv - Cell Biology 2023Quote: ... 2.5 million cells were dissolved into 100 µl of ICP-OES grade 65% HNO3 acid (Merck #1.00441.1000) and was kept at 95°C for overnight ...
-
bioRxiv - Developmental Biology 2022Quote: ... 0.25% sodium deoxycholate and 0.1% SDS (AppliChem) with an ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail (Merck), phosphatase inhibitor cocktail sets II and IV (Merck) ...
-
bioRxiv - Microbiology 2022Quote: ... cells were fixed and permeabilized with a 3:1 mixture of methanol (Klinipath)-glacial acetic acid (Merck) for 10 min ...
-
bioRxiv - Bioengineering 2023Quote: ... The mobile phase was 1.5 mmol L-1 phosphoric acid diluted in ultrapure water (MilliQ, Merck Millipore). The VFAs measured were acetic acid ...
-
bioRxiv - Cell Biology 2022Quote: ... Standard minimal medium (SMM) consisted of 0.67% yeast nitrogen base without amino acids (Merck, product number Y0626), supplemented with all standard amino acids [bought from Sigma (now Merck)] at 76 mg/l except leucine ...
-
bioRxiv - Biochemistry 2024Quote: ... a one-step gradient elution was achieved with elution buffer (0.1 M citric acid, Merck, pH 2.5). Resulting fractions were neutralized immediately with 1 M Tris (Serva ...
-
bioRxiv - Biochemistry 2024Quote: ... supplied with one tablet of ethylenediaminetetraacetic acid free SigmaFAST protease inhibitor cocktail tablet (Merck KGaA, Darmstadt, Germany) per 100 ml buffer ...
-
bioRxiv - Biophysics 2024Quote: ... with or without pre-treatment with 500 μM L-Ascorbic acid (Vitamin C) (Sigma-Aldrich/Merck, #A4544) for 1 hour ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1 mM ethylenediaminetetraacetic acid (EDTA)) using an ultra-centrifugal filter (Amicon ultra-4 [30 kDa]; Merck). The (His)6-tag was cleaved by reacting with HRV3C overnight at 4 °C ...