Labshake search
Citations for Merck :
701 - 750 of 1065 citations for Mouse Direct PCR Kit For Genotyping since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2019Quote: ... Tween 20 with 3 % (w/v) skim milk powder and successively incubated with monoclonal mouse anti-T7 RNA polymerase antibodies (Novagen, Merck) and POD labelled goat anti-mouse antibodies (Sigma) ...
-
bioRxiv - Molecular Biology 2019Quote: ... followed by washing and staining with horseradish peroxidase-conjugated donkey anti-rabbit or anti-mouse IgG secondary antibodies (1:5,000 dilution; Merck Millipore), respectively ...
-
bioRxiv - Neuroscience 2019Quote: ... AB5543), chicken anti-β3 tubulin (1:500, AB9354) and mouse anti-ankyrin G (1:500, MABN466) were purchased from Merck Millipore ...
-
bioRxiv - Molecular Biology 2021Quote: ... Secondary antibodies fused to HRP were used for detection (Goat anti-mouse HRP 1:3000, BioRad; Goat anti-rat HRP 1:3000, Merck Millipore ...
-
bioRxiv - Genetics 2021Quote: ... a mouse anti-glyceraldehyde-3-phosphate dehydrogenase monoclonal antibody (#MAB374, used at 1:10,000 for the Western blot analyses, Merck Millipore); a rabbit anti-LC3B polyclonal antibody (#2775 ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were incubated with mouse monoclonal Alexa Fluor-488 conjugated antibody against NeuN (1:200, MAB377X, Merck Millipore, MA, USA) or the rabbit polyclonal primary antibody against DISC1 (1:250 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The following antibodies were used for ChIP analysis: Mouse anti-RNA polymerase II antibody clone CTD4H8 (Merck Millipore, 05-623), Rabbit anti-NF-kB p65 antibody clone D14E12 (Cell Signalling ...
-
bioRxiv - Molecular Biology 2023Quote: The shRNA sequence in pLKO.3-GFP lentiviral vector against mouse KIS was GAGTGCGGAGAATGAGTGTTT (MISSION shRNA library, TRCN0000027622) and control non-mammalian shRNA was from Merck-Sigma (SHC002) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were run on SDS-PAGE and the expression of IDO1 was analyzed with a mouse anti-IDO1 antibody (clone 8G-11, Merck). Mouse monoclonal Ab against β-tubulin (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... after testing multiple antibodies (anti-NeuN rabbit Antibody, ABN78 & ABN78C3, Merck; anti-NeuN rabbit Antibody, ab177487, Abcam; anti-NeuN mouse Antibody, MAB377, Merck) and increasing antibody concentrations (up to 1:50) ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were incubated for 1 h at RT with a mouse anti-2A primary antibody (cat. no. MABS2005, Merck) diluted 1:2000 in 1% (w/v ...
-
bioRxiv - Microbiology 2023Quote: ... the fixation procedure above with and without subsequent membrane permeabilization was used in infected/uninfected organoids that were then stained with a mouse monoclonal anti-mitochondria antibody Cy3 conjugate (Merck) incubated overnight at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: Proximity ligation assays with Aurora A kinase and MP-GAP were performed in HeLa cells using mouse anti-Aurora A Kinase antibody (1:500, A1231 Merck), rabbit anti-MP-GAP antibody (1:250 ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by incubation with a rabbit anti-Kv4.3 primary antibody (1:10000, Alomone Labs) together with chicken (G)/mouse (L) anti-TH primary antibody (1:1000, Abcam / Merck) in a carrier solution (1% NGS ...
-
bioRxiv - Bioengineering 2023Quote: ... Then these samples were incubated in Alexa Fluor 488 conjugated mouse monoclonal anti-CTSK antibody (1:100) at 4°C overnight (Merck) and then for 1h under agitation at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated overnight with an anti-GFP rabbit antibody (0.5 μg/ml) (Tamamaki et al., 2000) and an anti-Cre recombinase mouse monoclonal antibody (1:1,000; MAB3120, Merck Millipore). After a rinse ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... CDK9 was immunoprecipitated with 15μg of an anti-CDK9 antibody (D-7, sc-13130, lot no # B1422) or control mouse IgG (12-371, Merck) in IP Buffer with 2X SDS buffer (100mM NaCl ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:10,000 WB) and mouse monoclonal antibody recognizing the N-terminus β-Actin (#A5441, 1:10,000 WB) were purchased from Merck. Rabbit polyclonal phosphomyosin (Thr18/Ser19 ...
-
bioRxiv - Cancer Biology 2023Quote: ... one mouse was exposed by drinking water to a mixture of BPA (1 µM, CAS no. 80-09-1, Merck) and DEHP (1 µM ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were incubated with secondary antibodies conjugated with PLA probes MINUS and PLUS: the PLA probe anti-mouse PLUS and anti-rabbit MINUS (Merck). Incubation with all antibodies was accomplished in a humidified chamber for 1 h at 37 °C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... we followed Magna-Chip™ A/G kit (from Merck) protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... ApopTag plus peroxidase in situ apoptosis detection kit (Merck Millipore) was used according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2019Quote: Plasma insulin was determined using a commercial kit (Merck Millipore) on a MAGPIXTM Multiplex reader and processed using Bio-Plex ManagerTM MP.
-
bioRxiv - Bioengineering 2021Quote: Bromocresol Purple (BCP) Albumin Assay Kit (Sigma-Aldrich, Merck, Germany) performed as per manufacturer’s instructions with plasma samples diluted 5-fold in ultrapure water ...
-
bioRxiv - Microbiology 2021Quote: ... GLP-1 (GLP-1 total ELISA kit, Merck, Darmstadt, Germany) and biochemical parameters including ALT ...
-
bioRxiv - Microbiology 2021Quote: ... following staining with a Gram stain kit (Merck, Darmstadt, Germany).
-
Large-scale conformational changes of FhaC provide insights into the two-partner secretion mechanismbioRxiv - Biophysics 2022Quote: ... the ECL kit of Amersham (Merck, St Quentin-Fallavier, France) and the Amersham Imager 600 (GE ...
-
bioRxiv - Developmental Biology 2022Quote: ... the ApopTag Red In Situ Apoptosis Detection Kit (Merck, S7165) was used ...
-
bioRxiv - Neuroscience 2020Quote: The Black Gold II staining kit (Merck Millipore, Chengdu, China) was used according to the manufacturer’s instructions(Santiago Gonzalez et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... and libraries were extracted using GenElute plasmid miniprep kit (Merck).
-
bioRxiv - Molecular Biology 2023Quote: ... Fixed colonies were stained with the Alkaline Phosphatase kit (Merck) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Duolink™ In Situ Probemaker PLUS kit (Merck, DUO92009-1KT) was applied to conjugate PLA oligonucleotides (PLUS ...
-
bioRxiv - Evolutionary Biology 2023Quote: A Magna RIP Kit (Cat# 17-704, Merck, Millipore, Germany) was used to perform the RIP assay following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Anti-Citrulline (Modified) Detection Kit (cat. 17-347B, Merck) was used to measure global citrullination 88 ...
-
bioRxiv - Plant Biology 2023Quote: A chromatin immuno-precipitation Kit (Merck Millipore, Burlington, MA, USA) was used to perform ChIP-qPCR assays ...
-
bioRxiv - Developmental Biology 2023Quote: ... 900 μL of RIP Immunoprecipitation Buffer (Magna RIP kit, Merck) supplemented with 200 U RNaseIn was mixed with 100 μl of the lysate and this mixture was used to resuspend the antibody-coupled beads ...
-
bioRxiv - Molecular Biology 2023Quote: A Chromatin Immunoprecipitation (ChIP) Assay Kit (Merck Millipore 17-295) was used for all CTCF ChIP experiments following manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... and ESGRO-2i Supplement Kit (1:1000, #ESG1121; Merck KGaA)] in a humidified incubator at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: Duolink™ In Situ Probemaker PLUS kit (Merck, DUO92009-1KT) was applied to conjugate PLA oligonucleotides (PLUS ...
-
bioRxiv - Plant Biology 2020Quote: ... the ORF of CLEL6 lacking the predicted signal peptide was amplified by PCR from a previous construct and cloned into the NcoI restriction site of pETDuet1 (Novagen/Merck KGaA, Darmstadt, Germany). Correct orientation and translational fusion with the C–terminal His-tag was verified by sequencing ...
-
bioRxiv - Plant Biology 2020Quote: ... ORFs of PSK1 and RGF1 lacking the predicted signal peptides were amplified by PCR from cDNA and cloned into the NcoI restriction site of pETDuet1 (Novagen/Merck KGaA, Darmstadt, Germany). C-terminal His tags were added by including 6 His codons in the reverse PCR primers ...
-
bioRxiv - Plant Biology 2021Quote: ... The dried extracts were dissolved in 350 μl purified water and filtered through MultiScreen PCR-96 Filter Plate membranes (Merck Millipore, Darmstadt, Germany) to remove high-molecular-mass compounds ...
-
bioRxiv - Biophysics 2021Quote: ... The antibody was revealed using Atto 594 goat anti-mouse IgG (1:500, 76085-1ML-F, Merck & Co., Kenilworth, NJ, USA). The coverslips were rinsed in PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were blocked in 5% skim milk in TBS for 1 hour and probed with mouse γ/9d 2G10.2 (1:1000, MERCK MABT1335), rabbit anti mouse IgG (1:3000 ...
-
bioRxiv - Immunology 2021Quote: ... Mouse peritoneal macrophages (MPMs) were isolated from mice 4 d after the intraperitoneal injection of thioglycollate (Merck & Co.; Kenilworth, NJ, USA) as described previously(Zhang et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... The sections were collected in PBS in 24-well plates and processed for free-floating immunofluorescence using primary polyclonal antibodies that label neurons (NeuN, mouse; 1: 1000, Millipore MAB377, Merck Millipore), reactive astrocytes (GFAP ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... the slides were incubated for 1 h at room temperature with the appropriate biotin-conjugated secondary antibody: goat anti-mouse (21538, Merck-Millipore) for CD3 and goat anti-rat (BP-9400 ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were transferred to well-plates for exposure to two primary antibodies (RFP antibody 5F8 rat for mCherry, RRID: AB_2336064, Chromotek, 1:1000; and mouse-monoclonal anti-CaMKIIα, RRID: AB_309787, Merck Millipore, 1:300) which were added to 0.1 M PBS-Tx 0.2% containing 5% normal goat serum ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies were detected with horseradish peroxidase conjugated anti-rabbit and anti-mouse antibodies and visualized by enhanced chemiluminescence detection (Luminata Forte Western HRP substrate, Merck Millipore). Digital images were acquired on a ChemiDoc XRS System (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... Lysates were centrifuged for 5 min at 20 000 x g and supernatants were immunoprecipitated for 1 h rotating at 4°C with mouse anti-GFP antibody (1 µg antibody per sample, 11814460001 Merck/Sigma) and 20 µl DynabeadsTM Protein G (10004D ...