Labshake search
Citations for Merck :
601 - 650 of 1065 citations for Mouse Direct PCR Kit For Genotyping since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... firstly with anti-DIG2 (sheep anti-mouse Ig digoxigenin conjugate, 1:200, Merck Millipore, Billerica, MA, USA) and antistreptavidin (1:25 ...
-
bioRxiv - Neuroscience 2022Quote: ... Secondary antibodies used for Western blotting were Goat-Anti-mouse IgG HRP conjugated (catalog #12-349; Merck) and Goat-Anti-rabbit IgG HRP conjugated (catalog #12-348 ...
-
bioRxiv - Cell Biology 2022Quote: ... 1:600-diluted rabbit anti-CENP-C (#554),55 mouse anti-HP1α (1:1,000, #MAB3584, Merck Millipore), rabbit anti-HP1β (1:800 ...
-
bioRxiv - Neuroscience 2023Quote: ... NBP1-92693AF647) and the oligodendrocyte transcription factor OLIG2 (Anti-OLIG2 clone 211F1.1 mouse mAb, Merck Millipore, MABN50A4). Samples were kept on ice throughout the isolation and staining procedure ...
-
bioRxiv - Biochemistry 2023Quote: ... Antibodies usedwere: mouse monoclonal (BIII-136) anti human Band 3 (B9277, Merck Life Science S.r.l., Milan, Italy). Mouse monoclonal (H68.4 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated overnight at 4 °C with primary antibodies against puromycin (mouse monoclonal 1:500, Merck), Par3 (rabbit polyclonal 1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated overnight at 4 °C with an anti-puromycin antibody (mouse monoclonal 1:500, Merck) combined with an anti-β-actin antibody (rabbit polyclonal 1:1000 ...
-
bioRxiv - Microbiology 2023Quote: ... and VEGF content was quantified using a custom-made Milliplex Mouse Cytokine/Chemokine Panel (Merck Millipore, USA), a magnetic bead-based multiplex immunoassay following the manufacturer instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... The following primary antibodies were used for immunofluorescence in Drosophila: mouse anti-puromycin (clone 12D10, Merck Millipore) at 1:200 ...
-
bioRxiv - Immunology 2024Quote: ... and as secondary antibody goat anti-mouse polyclonal antibody conjugated with horse radish peroxidase (HRP) from Merck Millipore was used at a dilution of 1:3500 ...
-
bioRxiv - Cell Biology 2019Quote: Multiplex analysis based on the xMAP Luminex technology was performed with the use of a kit for MILLIPLEX MAP Porcine Cytokine/Chemokine (magnetic) kit # PCYTMG-23K-13PX (Merck), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: Chromatin was isolated from 20 million cells using the Magna ChIP A/G Kit (One-day chromatin Immunoprecipitation Kits, Merck) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... These samples were stored in the dark and analyzed colorimetrically using a commercial kit (Spectroquant Sulfide kit, Merck, Schaffhausen, Switzerland). Total particulate nitrogen and carbon were determined by filtration of 100 to 220 mL lake water on pre-combusted (400°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real time quantitative PCR was performed with KAPA SYBR FAST qPCR Master Mix (Sigma-Aldrich - Merck, UK, cat no KK4602) according to manufacturer’s instructions in a StepOnePlus Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... CDC50.3 and CDC50.4 were generated using a PCR fragment encoding the mAID–HA and the HXGPRT cassette produced using the KOD DNA polymerase (Novagen, Merck) with the vector pTUB1:YFP-mAID-3HA as template and the primers indicated in Table S2 ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... aeruginosa PAO1 served as a template for the amplification of the genes of interest via PCR using the KOD Xtreme polymerase (Novagen/Merck) and cloning primers containing the restriction sites (Eurofins Genomics) ...
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biochemistry 2020Quote: ... Cell debris was removed by centrifugation at 15k g for 1 min and 1 µl of the supernatant was used as template DNA for 25 µl PCR reaction (KOD HotStart, Merck) with primers NbLib-fwd-i (CAGCTGCAGGAAAGCGGCGG ...
-
bioRxiv - Plant Biology 2022Quote: ... The PCR product was cloned using the hot fusion method (Fu et al., 2014) in pET30a+ vector (Merck, Molsheim France) pre-digested with EcoRI and BglII in order to fusion AgLTP24 with a N-terminal 6XHis flag ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR amplification of the Round 1 PCR product (1 ul) with 1 ul of JH reverse primer (10 uM, provided by MERCK) and 1 ul of FR1 forward primer set pools (10 uM per primer ...
-
bioRxiv - Cell Biology 2024Quote: ... Truncated forms were generated by PCR of the entire plasmid except the region to be excluded using KOD HotStart DNA polymerase (Merck) and the forward primers pUL71 295 fwd ...
-
bioRxiv - Molecular Biology 2020Quote: ... An enhanced chemiluminescence (ECL) detection kit (Merck Millipore) was used to develop the membranes ...
-
bioRxiv - Cell Biology 2022Quote: ... the Senescence Cells Histochemical Staining Kit (Merck, UK) was used according to the manufacturer’s guidelines ...
-
bioRxiv - Cancer Biology 2019Quote: The Muse Ki67 Proliferation kit (Merck, Princeton, USA) was used to detect proliferating and non-proliferating cells based on Ki67 expression ...
-
bioRxiv - Microbiology 2022Quote: ... Live/dead Double Staining Kit (Merck Life Sciences) was used to stain cells followed by microscopy ...
-
bioRxiv - Microbiology 2023Quote: ... difficile using the succinate colorimetric assay kit (Merck) according to the manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2023Quote: A multiplex assay kit (HNABTMAG-68K, Merck Millipore) was used to quantify Aβ40 ...
-
bioRxiv - Molecular Biology 2024Quote: ... LCAT activity assay kit (Sigma-Aldrich MAK107, Merck) was used according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: ... ECL kits and absolute ethanol were from Merck-Millipore (Germany) ...
-
bioRxiv - Cancer Biology 2024Quote: ... as per the manufacturer’s protocol (Merck EZChIP kit). Subsequently ...
-
bioRxiv - Biochemistry 2020Quote: ... and mouse monoclonal anti-APP (1:500, 22C11; Cat#Mab348, RRID: AB_94882, Merck Millipore/Sigma, Burlington, MA, USA) antibodies were purchased from the indicated suppliers ...
-
bioRxiv - Neuroscience 2021Quote: ... brain slices of mice were also incubated with a mouse NeuN (1:500, conjugated with AF488 MAB377X, Merck) and a rabbit GFAP antibody (1:1000 ab7260 ...
-
bioRxiv - Neuroscience 2020Quote: ... neuronal somata were visualized by NeuN immunolabeling (1:1000, monoclonal mouse anti-NeuN IgG, #MAB377, /Merck, Darmstadt, Germany) in CRH-ires-cre ...
-
bioRxiv - Cancer Biology 2019Quote: ... The cells were incubated for one hour at room temperature with a mouse monoclonal antibody against γH2AX (Merck) diluted in PBS/SVF (1/1000 ...
-
bioRxiv - Physiology 2019Quote: Mouse intestine was fixed with 2.5% glutaraldehyde (Agar Scientific, Stansted, Essex, UK) and 2% paraformaldehyde (Merck, Darmstadt, Germany) in 0.1M Na-cacodylate-buffer (Merck ...
-
bioRxiv - Neuroscience 2019Quote: ... The membranes were also stained with a mouse anti-actin antibody for 1h at room temperature (#MAB1501R, Merck).
-
bioRxiv - Neuroscience 2021Quote: ... Samples were incubated overnight at 4°C with monoclonal anti-NeuN antibody (1:500; Mouse, MAB377, Merck Millipore), in a 50% dilution of blocking buffer + 0.5% Triton X-100 ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were then incubated with 0.5 μg/ml of mouse anti-phosphotyrosine monoclonal antibody 4G10 (Merck, Darmstadt, Germany) at 4°C overnight ...
-
bioRxiv - Microbiology 2023Quote: ... the membranes were incubated with a 50,000-fold-diluted HRP-labelled anti-mouse or rabbit IgG antibody (Merck) at room temperature for 2 hours or more ...
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibodies were used: anti-APC mouse monoclonal antibody (1:200; Merck Millipore, Burlington, MA, USA), anti-GFAP-488 mouse monoclonal antibody (1:300 ...
-
bioRxiv - Bioengineering 2023Quote: ... The blood was flushed out by perfusing the mouse with heparin in PBS (20U/ml, 375095-100KU, Merck) through the heart using a continuous flow syringe pump (4ml/min ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were washed 3 times with PBS-T for 5 min and incubated with mouse-HRP (A4416; Merck) and rabbit-HRP (GENA9640V ...
-
bioRxiv - Cell Biology 2024Quote: ... cover slips were incubated with the primary antibody (SV40 T antigen mouse-anti-human, Merck-Millipore, 1:50) overnight at 4 °C in a humidifier chamber ...
-
bioRxiv - Immunology 2024Quote: ... plates were washed in PBS/T and incubated for 1 h with goat anti-mouse IgG-AP (Merck). Plates were then developed as per the mAb ELISA ...
-
bioRxiv - Microbiology 2022Quote: ... Cytokine and chemokine levels were measured with a commercial rat cytokine/chemokine magnetic bead panel 96-well plate assay kit (Milliplex MAP kit, Merck Millipore), which detects 5 cytokines and chemokines including IP-10/CXCL10 ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Molecular Biology 2019Quote: ... Amplified DNAs were purified with a Wizard SV Gel and PCR Clean-Up System and were used for in vitro transcription with Fluorescein RNA labeling Mix (Merck, #11685619910) and T7 (Merck ...
-
bioRxiv - Plant Biology 2019Quote: ... A 323 bp fragment was amplified from CAM leaf cDNA using high fidelity PCR with KOD Hot Start DNA Polymerase (Merck, Germany). The amplified fragment spanned the 3’ end of the PPC1 coding sequence and extended into the 3’ untranslated region to ensure specificity of the silencing to both of the aforementioned CAM-associated PPC1 gene copies ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.