Labshake search
Citations for Merck :
651 - 700 of 1059 citations for Rat Leucine Rich Pentatricopeptide Repeat Containing LRPPRC ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Triton X-100 and incubated for 48 h in the sealed jars in the presence of a perforated tube containing vermiculite saturated with 7.43 g/100 mL KMnO4 solution (Merck, Darmstadt, Germany) as described by Ophir et al ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were subsequently washed 3 times for 10 minutes with PB containing 0.2 % Triton X-100 (Merck, Darmstadt, Germany, 108603; PBT). Next ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were subsequently washed 3 times for 10 minutes with PB containing 0.2 % Triton X-100 (Merck, Darmstadt, Germany, 108603; PBT). Next ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Germany) were grown in RPMI 1640 medium containing 10% heat-inactivated fetal calf serum (FCS, GE Healthcare, Freiburg, Germany or Merck) at 37°C and 5% CO2 ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Negative control lines ‘NC’ and ‘NC#2’ were generated with U6gRNA-pCMV-Cas9–2A-GFP containing the guide tatgtgcggcaaaccaagcg (CRISPR08; Sigma-Aldrich/Merck). For three days prior to transfection ...
-
bioRxiv - Microbiology 2024Quote: ... pH 7.0) containing the cOmpleteTM EDTA-Free protease inhibitor at a 1 x concentration following manufactureŕs instructions (Merck Millipore, Darmstadt, Germany). The buffer volume was proportional to the cell density of the sample ...
-
bioRxiv - Immunology 2024Quote: ... All Hoxb8-Fl cell lines were cultured in very low endotoxin containing RPMI 1640 (PAN-Biotech) supplemented with 10% FBS (Sigma-Aldrich/Merck), 2mM L-glutamine ...
-
bioRxiv - Immunology 2024Quote: ... cell lysates of macrophages were removed and the infected Vero cells were overlaid with the Vero culture medium containing 0.5% methylcellulose (Sigma-Aldrich; Merck KGaA) for 4 days ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2958 bp) was purified using commercial DNA purification kits (GenElute™ HP Plasmid Miniprep kit, Merck, #NA0160), according to standard procedures ...
-
bioRxiv - Cell Biology 2020Quote: ... for 3h at 16°C to remove the 6-His and MBP tag before phase separation in reaction mixtures in buffer C containing 10μM of WT or W1145R TopBP1b6-8-GFP and 2% of PEG4000 (Merck-Sigma-Aldrich, 95904). Reaction mixtures were mixed by gently tapping the Eppendorf ...
-
bioRxiv - Biochemistry 2021Quote: ... The cells were fixed for 1 h at room temperature with 4% buffered formalin solution containing 1% crystal violet (Merck, Darmstadt, Germany). Finally ...
-
bioRxiv - Molecular Biology 2020Quote: ... CsCl fractions containing needle complexes and the substrate were pooled and incubated with Anti-FLAG M2 magnetic beads (M8823, Sigma Aldrich/Merck KGaA) prewashed in FR3 buffer (10 mM Tris-HCl ...
-
bioRxiv - Immunology 2021Quote: ... wells washed with 1 X PBS and incubated with 50 µL of incomplete media containing 5 µM Laurdan (Avanti® Polar Lipids, Merck, USA) for 30 min at 37°C ...
-
bioRxiv - Microbiology 2019Quote: ... 1 mL of the pre-enriched suspensions for each drinking water sample was added to sterile tubes containing 9 mL of TTB (Merck, South Africa). The suspensions were subjected to incubation at 36 ± 1 °C overnight ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: An emulsion was created containing corn oil for DPhP and TPhP resuspension and animal exposure and 50% of corn oil from Merck (Darmstadt, Germany).
-
bioRxiv - Neuroscience 2020Quote: ... and the fractions containing pure α-syn were pooled and concentrated using a 30 kDa molecular weight cut-off (MWCO) filters (MERCK, UFC903008) at 4 °C ...
-
bioRxiv - Biophysics 2021Quote: ... and the flow-through fractions containing the MgtE TM domain protein were concentrated using an Amicon Ultra 50 K filter (Merck Millipore, USA). After concentration ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 × 105 cells were seeded on the upper chamber of 24 well plate cell culture inserts containing 3 μm pores (Merck, Cat # 353096) coated with rat-tail collagen I (Sigma ...
-
bioRxiv - Biophysics 2022Quote: ... The oligonucleotides were dissolved at 100 μM in 10mM Tris-HCl buffer (pH 8.0) containing 1mM EDTA purchased (Merck Millipore, MA, USA) and stored at −20 °C for further use.
-
bioRxiv - Cancer Biology 2022Quote: ... and the supernatant containing the sheared chromatin was pre-cleared with Protein G plus-Agarose beads (Cat No. IP04-1.5ML, Merck Millipore, Burlington, USA), which were pre-coated with bovine serum albumin (BSA ...
-
bioRxiv - Immunology 2022Quote: ... were immunized by subcutaneous injection of 100 µL of an emulsion containing 200 µg of MOGp35–55(GeneCust, Boynes, France) in complete Freunds adjuvant (Merck, Burlington, MA) supplemented with 400 µg heat-killed M ...
-
bioRxiv - Immunology 2022Quote: ... coli transformed with plasmid pET42 expressing N-terminally GST- and HIS-tagged human IL-18 were grown at 37°C in Lysogeny broth (LB) medium containing kanamycin (25 μg/ml) as selection marker for the pET42a plasmid (Cat No 70561, Novagen, Merck, Overijse, Belgium). When the optical density at 600 nm (OD600 ...
-
bioRxiv - Pathology 2022Quote: ... The sections were incubated overnight at 4°C in a pre-incubation solution containing mouse monoclonal em48 (Merck Millipore; MAB5374, 1:400) and rabbit polyclonal Laminin (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by 10 min incubation at RT with 50% (v/v) lead citrate solution in decocted H2O containing 80 mM lead citrate (Merck, Darmstadt, Germany) and 0.12 M trisodium citrate (AppliChem ...
-
Farnesyltransferase inhibition overcomes the adaptive resistance to osimertinib in EGFR-mutant NSCLCbioRxiv - Cancer Biology 2022Quote: ... fixed with paraformaldehyde 4 % solution for 10 min and stained with a solution containing PBS - 0.5% crystal violet (Sigma-Aldrich/Merck, ref: C3886) – 25% methanol for 10 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... half of the medium was replaced with fresh medium containing 20 μM of 5-fluorodeoxyuridine and uridine (Sigma Aldrich, Merck, Darmstadt, Germany) every 3 days ...
-
bioRxiv - Developmental Biology 2022Quote: ... 32.8 mM 20:4 and 60 mM 22:6) and pipetted dropwise into N2 media containing 3 mM fatty acid-free BSA (Merck, Cat. #A8806) at 37°C with constant stirring to obtain final concentrations of 3 mM 18:0 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The medium containing the virus was collected 48 hours post-transfection and filtered through a 0.45 µm polyethersulfone (PES) filter (Merck Millipore, Billerica, MA).
-
bioRxiv - Microbiology 2022Quote: ... The resulting supernatant containing the MCR-1 solubilized in DDM detergent micelles was filtered using an 0.22 µm syringe filter (Merck Millipore, Darmstadt, Germany) and applied onto a HisTrap HP 5 ml affinity chromatography column (GE Healthcare ...
-
bioRxiv - Synthetic Biology 2022Quote: ... All yeast transformations were plated on synthetic complete (SC) plates containing 1.7 g/L yeast nitrogen base without amino acids and ammonium sulphate (Sigma Aldrich, Merck Life Science), 1 g/L monosodium glutamate (Sigma Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were mounted in CitiFluor™ CFM3 mounting medium (proSciTech, Australia) containing 3 μg/uL 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Merck, Germany) to stain nucleic acids ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were incubated for 1 hour with 1% BSA blocking solution containing DAPI at 1:4,500 (Merck Life Sciences, Cat #: D9542), phalloidin at 1:350 (Merck Life Sciences ...
-
bioRxiv - Genomics 2023Quote: ... a ∼20%-confluent wild-type iPSC culture in a 12-well plate containing 1 ml/well of Essential 8 supplemented with 10 µM ROCK inhibitor (Merck, cat# Y0503) was co-transfected with the pZT-C13-L1 and pZT-C13-R1 plasmids (Cerbini et al ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: CC strips were dissected and then transferred to microtiter plate wells containing 5 μM bis-N-methylacridinium nitrate (Lucigenin; Merck, Darmstadt, Germany), some strips were stimulated with NADPH (100 μM ...
-
bioRxiv - Biochemistry 2023Quote: ... dehydrated with 100 μL acetonitrile and rehydrated with 25 μL trypsin solution, containing 5 ng/μL trypsin (cat # 37283, SERVA Electrophoresis GmbH, Heidelberg) in 3 mmol/L ammoniumbicarbonate (cat # 09830, Merck KGaA, Darmstadt). After 4 h incubation at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... fixed cells were pelleted (1500 RPM 5 min) and resuspended in PBS containing 20 µg/ml propium iodide and 200 µg/ml RNase (Merck Life science).
-
bioRxiv - Neuroscience 2023Quote: Flies were collected on the day of eclosion and kept in the dark on the fly media containing 0.4 mM all trans-Retinal (Merck, St. Louis, MO). 7-10 days old flies were cold-anesthetized using a temperature-controlled stage and mounted on a plastic plate with a small window using wax ...
-
bioRxiv - Neuroscience 2023Quote: ... Flies were raised at 25℃ and collected on the day of eclosion and kept in the dark for 7-10 days on the fly media containing 0.4 mM all trans-Retinal (Merck, St. Louis, MO). The experiments were performed with the “8-well” chamber (16 mm diameter x 10 mm height ...
-
bioRxiv - Biochemistry 2023Quote: ... The samples were loaded onto the nanoACQUITY UPLC Trapping Column (Waters Corporation, Milford, MA, USA) using a mobile phase consisting of water containing 0.1% formic acid (Merck KGaA, Darmstadt, Germany). Subsequently ...
-
bioRxiv - Cell Biology 2023Quote: ... each sample was incubated for 12 h (or overnight) in bleaching solution containing hydrogen peroxide solution (H2O2; Cat. No. H1009; Sigma-Aldrich, Merck, Germany) at a final concentration of 15% (v/v)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lentivirus-containing supernatant was collected at 48h and 72h post-transfection and then concentrated using Amicon Ultra 100 kDa filters (Merck, Rahway, NJ). Lentiviral titter was calculated by the % of GFP+ cells using flow cytometry on serial dilutions of concentrated lentivirus stock ...
-
bioRxiv - Microbiology 2024Quote: ... A 0.5 cm diameter sterile filter disk was drenched in 2 ml of AgNPs solution for 15 min and then placed in the edge of a Petri dish containing potato dextrose agar (PDA) medium (Merck, Darmstadt, Germany). A control dish comprising a disc drenched for 15 min in AgNO3 solution (1 mM ...
-
bioRxiv - Immunology 2024Quote: ... U-937 cells (2×105 cells/mL) were incubated in the culture medium containing 200 ng/mL of phorbol myristate acetate (PMA) (Sigma-Aldrich; Merck KGaA) for 24 h to induce differentiation into macrophage cells ...
-
bioRxiv - Cell Biology 2020Quote: Cellular Senescence Assay kit (Merck Millipore: KAA002) was used to detect senescent AML12 by SA β-Gal staining as per the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... with a customized Milliplex kit (Merck Millipore).
-
bioRxiv - Molecular Biology 2022Quote: ... and GenElute™ Plasmid Miniprep Kit (Merck), respectively ...
-
bioRxiv - Cell Biology 2020Quote: ... we used Sigma-Aldrich kit from Merck-Sigma ...
-
bioRxiv - Immunology 2023Quote: ... using Mouse Kapa Genotyping kit (Merck-Millipore), primers (500 nM ...
-
bioRxiv - Microbiology 2023Quote: ... Nutrient specific Spectroquant kit (Merck Millipore, US) was used and the concentration was determined spectrophotometrically using a 96-well plate with a microplate reader (FilterMax F5 ...
-
bioRxiv - Molecular Biology 2024Quote: Magna MeRIPTM m6A Kit (17-10499, Merck) was used to enable identification and transcriptome-wide profiling of m6A ...