Labshake search
Citations for Merck :
651 - 700 of 4934 citations for 1 Piperidin 4 yl azetidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... sodium acetate and formic acid (FA) were obtained from Merck (Darmstadt, DE). Acetonitrile and 0.1% FA were obtained from Biosolve (Valkenswaard ...
-
bioRxiv - Microbiology 2022Quote: ... γ-aminobutyric acid (GABA) standard and deuterium oxide were purchased from Merck GmbH (Darmstadt ...
-
bioRxiv - Biochemistry 2023Quote: ... Methanol (MeOH) and formic acid (FA) were purchased from Merck (Darmstadt, Germany). Acetic acid (AA) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we used an antibody targeting GAD (Glutamic Acid Decarboxylase, #G1563, MERCK, Germany) which catalyses the conversion of L-glutamate to γ-aminobutyric acid (GABA) ...
-
bioRxiv - Microbiology 2024Quote: ... Formic acid and HPLC-grade acetonitrile were purchased from Merck (Darmstadt, Germany). Ultrapure water was acquired from a Milli-Q water system (Millipore ...
-
bioRxiv - Cancer Biology 2024Quote: ... the grid was applied to 1.5% w/v phosphotungstic acid (PTA) (Merck) for 3 seconds and washed again using distilled for negative staining ...
-
bioRxiv - Cell Biology 2024Quote: ... and the cells were washed three times with 0.1% acetic acid (Merck). Images were taken from each well prior to the spectrophotometric analysis ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 × 105 Cas9 TNG MKOS MEFs were transduced with either a non-targeting control sgRNA or Zfp266 sgRNA lentivirus at an MOI of 3 with 8 µg ml−1 polybrene (Merck-Millipore) for 4 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transduced with either a non-targeting control sgRNA or Zfp266 sgRNA lentivirus at an MOI of 3 with 8 µg ml−1 Polybrene (Merck-Millipore) for 4 hours ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were washed in PBS for 3 times and Alexa Fluor 555 conjugated secondary goat anti-mouse IgG antibody (1:100; Merck, Germany) was added for immunostaining in the dark for 2 hours at RT ...
-
bioRxiv - Cell Biology 2023Quote: J774A.1 macrophages with or without infection (3 hour) were lysed in a specific lysis buffer containing DCP-Bio1 (Merck # NS1226) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... The selected elution fractions (1-3 of 500 μL each) were pooled and subsequently concentrated using 100-kDa Amicon centrifugal filter units (Merck Millipore). The concentrated samples were subjected to several washing steps with PBS to obtain a highly pure EV population ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3% BSA followed by overnight incubation at room temperature with rabbit anti-KCC2 IgG (1:1000 dilution; #07-432, Merck-Millipore) (Yassin et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... 200 μl of Protein powder solutions (1 mg/ml) were added to 3 cm NG plates with 10 µM 5-FU (Merck, #F6627). After the plates had dried ...
-
bioRxiv - Bioengineering 2024Quote: ... The activated microgels were then resuspended in 3 mL of PBS and 50 µL of 100 U mL−1 thrombin (Merck T1063) and stirred at room temperature overnight ...
-
bioRxiv - Genomics 2020Quote: ... Teratomas that developed within 4 weeks post-injection were harvested and fixed in 4% paraformaldehyde (Merck), embedded in paraffin ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed using 4% paraformaldehyde (Merck, 1040051000) in PBS and permeabilized by CSK buffer (25 mM HEPES pH 7.8 ...
-
bioRxiv - Genetics 2021Quote: ... fixed with 4% paraformaldehyde (PFA, Merck) in PBS (pH = 7.5) ...
-
bioRxiv - Cell Biology 2020Quote: ... and fixed in 4% paraformaldehyde (Merck) overnight at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... 4-amino pyridine (5 mM, Merck) and TTX (0.5-1 μM ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4 μg/ml heparin (Sigma/Merck), 20 ng/ml EGF (Peprotech) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 4 g/l thiamine-HCl (Merck), and 40 g/l myo-inositol (Merck) ...
-
bioRxiv - Genomics 2020Quote: ... and Tubulin beta 4 (#T7941, Merck). To do so ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 mM glutamine (Merck KGA, Germany), 1 mM sodium pyruvate (Merck KGA ...
-
bioRxiv - Bioengineering 2023Quote: ... 4 μg/mL PI (Merck, Germany) and 12 μg/mL Hoechst 33342 (Miltenyi Biotec ...
-
bioRxiv - Microbiology 2024Quote: ... were fixed with 4% formaldehyde (Merck) diluted in PBS 1X for 10 min at room temperature and then washed 3 times with PBS 1X ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by 4 % PFA (1004005, Merck) (w/v ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-Hydroxytamoxifen (4OHT) (Merck Sigma-Aldrich) was added at a final concentration 100 nM for 10-12 hours to induce the recombination of the Lynflallele.
-
bioRxiv - Bioengineering 2023Quote: ... MOWIOL 4-88 Reagent (475904, Merck); LysoTracker Deep Red (L12492 ...
-
bioRxiv - Bioengineering 2024Quote: ... MOWIOL 4-88 reagent (475904, Merck); High Pure RNA Isolation Kit (11828665001 ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Biophysics 2021Quote: ... 250 ng of each plasmid encoding VN and VC were transfected using 4 μL of 1 μg/mL PEI (Merck) for each μg of DNA ...
-
bioRxiv - Biophysics 2021Quote: ... fluorescently-labeled and biotinylated H57-scFV were concentrated to 0.2 - 1 mg/mL with 10 kDa Amicon®Ultra-4 centrifugal filters (Merck) and stored in 1x PBS supplemented with 50 % glycerol at -20°C ...
-
bioRxiv - Genetics 2020Quote: ... Bone tissue was cut into 2-mm pieces and placed in PBS buffer containing 4% paraformaldehyde (Schuchardt, Muenchen, Germany) and 1% glutaraldehyde (Merck, electron microscopy grade ...
-
bioRxiv - Neuroscience 2021Quote: ... After washing the sections were incubated overnight at 4°C with anti-NeuN antibody (1:1000, Merck Millipore, Cat. # ABN90P) in 1% normal goat serum and 0.1% Triton-X-100 in TBS ...
-
bioRxiv - Neuroscience 2020Quote: ... The blots were blocked in PBS/ 0,05%Tween20 containing 5% skim milk and then probed with the following primary antibodies over night at 4°C: mouse anti-P53 (1:100, Merck), rabbit anti-H2AX (1:1000 ...
-
bioRxiv - Neuroscience 2021Quote: ... then dialysed against the same stock of ITC buffer overnight at 4°C using 1 kDa Pur-a-lyzer tubes (Merck). Protein and RNA concentrations after dialysis were calculated by A280 and A260 absorbance respectively ...
-
bioRxiv - Physiology 2020Quote: ... blocked in 5% NGS and 0.5% Triton diluted in PBS and incubated over night at 4°C with primary antibody: rabbit anti-NG2 (1/50, AB5320, Merck), goat anti-PDGFRα (1/200 ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1 h at 4°C then moved to 37°C and incubated for 1 h with or without 100 µM cytochalasin D (Merck), 100 µM jasplakinolide (Abcam ...
-
bioRxiv - Neuroscience 2024Quote: ... or Tris-HCl buffered saline (TBS) and incubated at 4°C overnight with primary antibodies (anti-Nr4a2, Abcam, ab41917, 1:500 dilution; anti-GluA1, Merck-Millipore ...
-
bioRxiv - Molecular Biology 2024Quote: ... were mixed at a ratio of 4:1 based on monomer and injected onto a gel-filtration column (Superdex 200, 16/600, Merck) equilibrated in 20 mM HEPES buffer (pH 8.0) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Sections were washed and incubated overnight at 4°C with anti-Digoxigenin-AP antibody (45-11093274910 Merck-SIGMA, 1:1000). Staining was achieved by adding a solution of 4-Nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Microbiology 2023Quote: ... Clarification was then performed by centrifugation for 1 hour at 12,000g and 4°C and vacuum filtration using 45um nylon filter systems (SteriFlip - Merck Millipore). Prior to purification ...
-
bioRxiv - Cell Biology 2023Quote: ... The pooled fractions were diluted with 2 vols of KPEM buffer to achieve a final concentration of 125 mM KCl and then incubated for 1 hr with 4 mL anti-FLAG monoclonal antibody conjugated resin (M2 agarose, Merck) using rolling ...
-
bioRxiv - Bioengineering 2023Quote: ... Then these samples were incubated in Alexa Fluor 488 conjugated mouse monoclonal anti-CTSK antibody (1:100) at 4°C overnight (Merck) and then for 1h under agitation at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryo and skin sections were then incubated with the primary antibodies overnight at 4°C (LHX2, 1:1000, #3030529 Merck, Darmstadt ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were then incubated with one or more of the following primary antibodies in blocking buffer overnight at 4°C (rabbit anti-TH, 1:2000; AB152, Merck-Millipore ...