Labshake search
Citations for Merck :
551 - 600 of 2444 citations for Rat Insulin Like Growth Factor Binding Protein 5 IGFBP5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... A total of 50 μg of protein from each sample was transferred to a protein LoBind plate (Merck, NJ, USA). Protein was reduced with tris (2-carboxyethyl ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... while the rat abdominal aortic rings (15 mg wet mass/mL) were pre-incubated for 10 min in Medium 199 (Merck). The examined enzyme reaction started after pipetting the tracer substrate 1-14C-AA (3.7 kBq ...
-
bioRxiv - Neuroscience 2020Quote: ... A single intravitreal injection of ML240 or EerI to all P23H rats previously anesthetized (ST and LT: Diethyl ether, Merck Millipore ...
-
bioRxiv - Molecular Biology 2021Quote: ... Secondary antibodies fused to HRP were used for detection (Goat anti-mouse HRP 1:3000, BioRad; Goat anti-rat HRP 1:3000, Merck Millipore ...
-
bioRxiv - Neuroscience 2022Quote: ... Six rats received an infusion of 1.5 μL (n = 4) or 3.0 μL (n = 2) of 10% glycerol (Merck, Darmstadt, Germany) in phosphate-buffered saline (PBS ...
-
bioRxiv - Biophysics 2021Quote: ... Proteins were concentrated with Centricon filters (Merck-Millipore) when needed and/or diluted to a final concentration of 1 mg/mL in PBS.
-
bioRxiv - Cancer Biology 2021Quote: ... Proteins were detected by using Luminata Crescendo (Merck) and LAS600 (GE Healthcare) ...
-
bioRxiv - Cell Biology 2022Quote: ... Proteins were then transferred onto PVDF membranes (Merck) and blocked with 5% (wt/vol ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were transferred to PVDF membrane (#IPFL00010, Merck) for 3 hours at 60 V with Tris/Boric buffer at 50 mM/50 mM ...
-
bioRxiv - Cell Biology 2020Quote: ... Proteins were transferred onto PVDF membranes (Merck Millipore) by wet electroblotting for 1 h at 100 V using the Mini-PROTEAN Tetra system (Bio-Rad) ...
-
bioRxiv - Cell Biology 2022Quote: ... Proteins were then transferred to PVDF membranes (Merck).
-
bioRxiv - Cancer Biology 2019Quote: ... Proteins were detected using chemiluminescence HRP substrate (Merck). Densitometric protein quantifications were carried out by ImageJ.
-
bioRxiv - Cell Biology 2019Quote: ... Proteins were transferred to immobilon PVDF (Merck, IPVH20200) membranes at 100 V ...
-
bioRxiv - Immunology 2020Quote: ... Samples were precleared with Protein G Sepharose (Merck) for 30 min ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and rabbit anti-prosurfactant protein C (Merck, Germany)) both diluted 1:200 in 0.1% BSA and 0.1% Triton (Sigma-Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... or Protein A HRP (Cat # 18-160, Merck) at 1 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Chemicals and protein reagents were purchased from Merck, Sigma ...
-
bioRxiv - Immunology 2022Quote: ... Proteins were transferred to PVDF membrane (#IPFL00010, Merck) for 30 minutes at 100 V with Tris/Boric buffer at 50 mM/50 mM ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins were blotted to a PVDF membrane (Merck) for 1-2 h at 4°C with 300 mA constant current using the Bio-Rad immunoblot apparatus ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were transferred onto Immobilon transfer membrane (Merck) using a BioRad Trans-Blot turbo transfer system ...
-
LptM promotes oxidative maturation of the lipopolysaccharide translocon by substrate binding mimicrybioRxiv - Microbiology 2023Quote: ... protein gels were blotted onto PVDF membranes (Merck). Upon blocking with skim milk ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were transferred to PVDF membrane (#IPFL00010, Merck) for 3 h at 60 V or for 30 minutes at 100 V in blotting buffer (48 mM Tris ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the protein was concentrated using Amicon® (Merck) and stored in 50 mM Tris-HCl ...
-
bioRxiv - Immunology 2023Quote: ... the proteins were transferred onto PVDF membrane (Merck Millipore ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were transferred to PVDF membranes (MERCK-Millipore) using the Trans-Blot Turbo Transfer System (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant active DAPK3 protein was obtained from Merck.
-
bioRxiv - Microbiology 2023Quote: ... Proteins were transferred onto PVDF membranes (Merck Millipore). The membranes were blocked with skim milk ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein was transferred onto a PVDF membrane (Merck) at 60 V for 90 min in 1× NuPAGE Transfer Buffer (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were concentrated with either Aquacide II (Merck) or Amicon® Ultra Centrifugal Filters ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Immunology 2019Quote: ... WEHI-345 (0, 5 or 10 μM) 23 or Z-YVAD-fmk (0, 1, 5 and 10 μM; 21874; Merck, Australia) for 1 hr prior to stimulation with H ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and host plants was assessed by extracting the compounds following [6] by immersing the samples for 5 min in 5 ml of hexane (99%, SupraSolv, Merck, Germany), followed by removal from hexane with entomological tweezers that were previously cleaned with hexane ...
-
bioRxiv - Molecular Biology 2019Quote: To evaluate microscopic features of the captured cells such as morphological types and possible alterations we then used another collection membrane directly stained with hematoxylin and eosin after fixation for 10 min in a fixation solution (100 mL of 70% ethanol, 5 mL of glacial acetic acid and 5 mL of 37% formaldehyde solution – all solutions are from Merck Millipore). Samples were hydrated with distilled water for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Immunology 2024Quote: ... the MFI-value was converted to ng/mL by interpolation from a 5-parameter logistic (5-PL) curve of reference standard using the MILLIPLEX® Analyst 5.1 software (The Life Science/Merck KGaA).
-
bioRxiv - Developmental Biology 2020Quote: ... Fifty or thirty-five (depending on the protein detection) micrograms of proteins was separated on 9% Tricine gels and transferred to polyvinylidene difluoride membranes (Merck Millipore). The membranes were incubated separately with anti-Mmp-9 (1:1000 ...
-
bioRxiv - Plant Biology 2023Quote: ... The separated total proteins or proteins from two-dimensional gels were subsequently transferred onto polyvinylidene difluoride (PVDF) membranes (Merck, Cat. IPVH00010), hybridized with specific antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were transferred to well-plates for exposure to two primary antibodies (RFP antibody 5F8 rat for mCherry, RRID: AB_2336064, Chromotek, 1:1000; and mouse-monoclonal anti-CaMKIIα, RRID: AB_309787, Merck Millipore, 1:300) which were added to 0.1 M PBS-Tx 0.2% containing 5% normal goat serum ...
-
bioRxiv - Biophysics 2021Quote: Cultures of dissociated rat hippocampal primary neurons were prepared from postnatal P0-P2 Wistar rats of either sex and cultured on glass coverslips coated with 100 µg/mL poly-ornithine (Merck KGaA) and 1 µg /mL laminin (BD Biosciences) ...
-
bioRxiv - Neuroscience 2021Quote: Immunohistochemical staining was performed on free-floating brain sections using the following primary antibodies: mouse anti-rat TH (1:4000, MAB318, Merck Millipore), rabbit anti-Girk2 (1:500 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: The chemoreflex was activated by systemic bolus intravenous injections of 0.1 mL of KCN (40 μg per rat; Merck, Darmstadt, Germany) following procedures described by Franchini & Krieger (1993 ...
-
bioRxiv - Immunology 2021Quote: ... Freshly isolated cells (4 x 106) were seeded in a pre-prepared gel matrix containing 1 mg/mL rat tail collagen type I (Merck Millipore) in DMEM ...
-
bioRxiv - Neuroscience 2023Quote: ... brain hemispheres were dissected from postnatal Sprague Dawley rats (P0-P2) and dissociated with 0.25% trypsin (Sigma Aldrich, Merck, Darmstadt, Germany) and 0.004% DNAse (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: Astrocytes for long-term neuronal cultures were prepared by dissociating newborn rat cortices with 2.5% trypsin and 1 mg/ml DNase (Merck, cat# 10104159001) and plating the cells in MEM with L-glutamine supplemented with 0.6% glucose ...
-
bioRxiv - Neuroscience 2023Quote: ... rats were anesthetized and underwent transcardial perfusion with 100 mL of saline followed by 100 mL of 4% paraformaldehyde (Merck, Germany) at 72 h following ICH induction ...
-
bioRxiv - Neuroscience 2020Quote: ... fillet dissections of L3 larvae or pharate adults were performed in modified HL3 solution ([HL3-EGTA] 70 mM NaCl, 5 mM KCl, 10 mM NaHCO3, 20 mM MgCl2, 5 mM trehalose (Merck KGaA, 108216), 115 mM sucrose (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... followed by embedding in 5 % low melting agarose (Merck). Gelatinated blocks were washed in 0.1 M Soerensen’s phosphate buffer (Merck ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5% (v/v) Donkey serum (Merck Millipore, S30-100ML) for more than 1h at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... was equilibrated with 5 mM H2SO4 (Titrisol, Merck, Germany) in water at 55 °C and samples were eluted with 5 mM H2SO4 in water at a 0.3 ml/min flow rate.