Labshake search
Citations for Merck :
501 - 550 of 4618 citations for 1 2 Chloropyridin 3 yl 3 3 dimethylazetidin 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... glutamine-free RPMI was supplemented with 2mM [1,5-15N]-L-Glutamine or [3-13C]-L-Glutamine (Merck).
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Cell Biology 2024Quote: ... The eluate from each column was pooled and concentrated in a 3 KD amicon column (Merck, UFC5003) to just under 100 μl ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were later exposed to a 3% bovine serum albumin (BSA, A3912, Merck Life Science, Milan, Italy) solution in DPBS containing 0,1% Triton at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Cancer Biology 2024Quote: ... the AQR-GFP plasmid (RG220742) was used for the mutagenesis with KOD polymerase (Merck/Millipore, 71086□3), used according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... Microtubule-Associated Protein 2 (MAP-2) (Merck Millipore Burlington ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% glucose + 2% D/L-lactate (Merck), or 2% D/L-lactate alone [31].
-
bioRxiv - Cell Biology 2021Quote: ... were applied for one hour at room temperature and cells were counterstained with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI; Merck G8294; 1:3000) before mounting with Fluoromount™.
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed 3 times in TBS before being probed with protein A-peroxidase (Merck, 1:50000 in 10% Skimmed Milk in TBS). The membrane was incubated with 1x LumiGLO® / 1x Peroxidase (CellSignal ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were washed three times with DPBS for 5 minutes and incubated for 1 hour with respective secondary antibodies (Suppl. table 3) and DAPI (#10236276001; Merck Life Science, Dorset, UK) for nuclear counterstaining in 1% donkey serum ...
-
bioRxiv - Systems Biology 2023Quote: ... after adding 1 mL of chloroform:methanol 2:1 (v:v) (Merck), the sample was vortexed at 1200 rpm for 1 h at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1% penicillin-streptomycin and 0.00035% 2-mercaptoethanol (Merck)) to an orbital shaker ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of 1 M DTT (Merck, D9779) was added and the sample was heated for 10 min at 70°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... the MEK1/2 inhibitor PD0325901 (1 μM, Merck), LDN-193189 (100 nM ...
-
bioRxiv - Systems Biology 2023Quote: ... 4 mL of chloroform:isopropanol 2:1 (v:v)(Merck) were used to elute the neutral lipid fraction (NL) ...
-
bioRxiv - Microbiology 2020Quote: ... purified ParB was concentrated by centrifugation in an Amicon Ultra-15 3-kDa cut-off spin filters (Merck) before being loaded into a Superdex 75 gel filtration column (GE Healthcare) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mo and PN were then washed in DMEM and placed in 3 μm Boyden chambers (Merck Millipore, France), at the concentration of 0.5 x 106 cells/chamber in 200 µl DMEM ...
-
bioRxiv - Microbiology 2021Quote: ... purified ParBΔCTD was concentrated by centrifugation in an Amicon Ultra-15 3-kDa cut-off spin filters (Merck) before being loaded into a Superdex-200 gel filtration column (GE Healthcare) ...
-
bioRxiv - Biochemistry 2020Quote: ... and HPLC separation with a ZIC®-cHILIC column (3 µm, 100 Å, 150 mm × 2.1 mm, Merck) and a similar guard column (20 mm × 2.1 mm ...
-
bioRxiv - Physiology 2020Quote: ... at 4°C for 60 min using an Amicon Ultra-4 3 kDa centrifugal filter device (Merck Millipore). The 50 μL retentate was the final volume of concentrated EVs ...
-
bioRxiv - Systems Biology 2020Quote: Wnt signal inhibitor (CK) stock (2.4–3 mM): CKI-7 dihydrochloride (#C0742-5MG, Merck & Co., Inc., NJ, USA) diluted in distilled water (Otsuka Pharmaceutical Factory ...
-
bioRxiv - Cell Biology 2022Quote: ... The corresponding GST fusion protein was added to a final concentration of 15 µg/ml in incubation buffer (10 mM Tris pH 8.0, 150 mM NaCl, 0.1 % Tween-20, 3 % BSA (fatty acid free, Merck)) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... F2 FLAG-tagged TBP::NveRLR::mCherry and wild-type zygotes were treated with 3% L-Cysteine (Merck Millipore), washed and snap frozen in liquid nitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 3 µL of sample was carefully spotted onto pre-washed PEI-cellulose TLC plates (Merck Millipore, #105725). The TLC plate was eluted in developing buffer containing 10 mM NH4Cl and 5% acetic acid for 100-140 min ...
-
bioRxiv - Neuroscience 2020Quote: ... the eluate was up-concentrated to 3 ml using an Amicon Ultra 3000 MW centrifugal filter unit (Merck). Concentration assessment with a NanoDrop (∊ = 2980 ...
-
bioRxiv - Cell Biology 2021Quote: ... Transfections of DNA plasmids were carried out with the NanoJuice Transfection Kit (71900-3, Merck, Kenilworth, NJ, USA) or the Avalanche-Everyday Transfection Reagent (EZT-EVDY-1 ...
-
bioRxiv - Microbiology 2023Quote: Supernatants showing biological activity were concentrated using Amicon Ultra-0.5 centrifugal filters (3 kDa) (Merck KGaA, Darmstadt, Germany) as follows ...
-
bioRxiv - Immunology 2023Quote: Peripheral blood mononuclear cells were thawed in the presence of benzonase (Merck 70746-3, used at 1µl/ml), cells were counted and up to 3 x 106 cells were processed for mass cytometry ...
-
bioRxiv - Neuroscience 2023Quote: ... and the slices were placed on Millicell membranes (3–4 slices per membrane, 0,4 µm Millicell, Merck Millipore). Slices were cultured in DMEM/F-12 with GlutaMax ...
-
bioRxiv - Genetics 2023Quote: ... Supernatant was then transferred to an Amicon Ultra-0.5 Centrifugal Filter Unit 3 kDa (Merck Millipore, no. UFC500396) and centrifuged for 45 min at 4 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein was concentrated to ∼500 μL using Amicon Ultra-15 Centrifugal Filter Units (Merck Millipore MWCO 3 kDa). The concentration of proteins was determined using JASCO V730 UV-vis spectrophotometer at 280 nm ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were washed 3 times with PBS-T for 5 min and incubated with mouse-HRP (A4416; Merck) and rabbit-HRP (GENA9640V ...
-
bioRxiv - Cell Biology 2022Quote: ... expanding cells were transferred to erythroid differentiation medium (Iscove’s medium with stable glutamine [Merck] containing 3% (v/v) AB serum [Merck] ...
-
bioRxiv - Physiology 2023Quote: ... Samples were separated on a SeQuant ZIC-pHILIC column (100 3 2.1 mm, 5 mm, polymer, Merck-Millipore) including a ZIC-pHILIC guard column (2.1 mm x 20 mm ...
-
bioRxiv - Biochemistry 2023Quote: ... and centrifuging in 10 K (3 K for dA) ultra-centrifugal filters Amicon® (Merck KGaA, Darmstadt, Germany). This process was repeated five times to dialyze the ligand ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pellets were resuspended in 50µl NMR buffer (100 mM sodium phosphate, 500µM Sodium 3-(trimethylsilyl)propionate (TMSP; Merck), 10% D2O ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were then washed through three 70μl drops of PBST before being transferred to 50μl drops of blocking 3% BSA (Merck) in PBST for 30 minutes ...
-
bioRxiv - Immunology 2022Quote: ... washed again twice in TBS and then blocked with 3% BSA (Carl Roth) and 0.1% Tween-20 (Merck) in TBS at RT for 1 h ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was applied to 3 kDa MWCO filters (Amicon Ultra-0.5 Centrifugal Filter; Merck Millipore, Darmstadt, Germany), and centrifuged at 14,000 × g for 45 min at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: Treatments for the LC3 assay included 3 hours with mTOR inhibitor Torin1 (Merck-Millipore, final concentration 250 nM), Bafilomycin A1 (Sigma ...
-
bioRxiv - Physiology 2024Quote: ... washed in tap water for 3 min and stained with 0.02% Fast Green for 30 seconds (F7252, Merck), followed by 1% acetic acid for 30 seconds and Safranin’O solution for 45 min (S2255 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The dialyzed solution was concentrated using an Amicon Ultra-0.5 Centrifugal Filter Unit (3 kDa cutoff) (Merck Millipore). The purity of the purified protein was confirmed by SDS‒PAGE (49) ...
-
bioRxiv - Molecular Biology 2024Quote: ... animals were transferred to 3 cm NGM agar plates containing 5-Fluorouracil (5-FU) (10 µM) (Merck, #F6627) to prevent progeny production ...
-
bioRxiv - Biophysics 2024Quote: ... The 1,2-Distearoyl-sn-glycero-3-phosphocholine (DSPC, CAS: 816-94-4) was sourced from Merck (Darmstadt, Germany). Cholesterol (Chol ...
-
bioRxiv - Microbiology 2020Quote: ... Mueller Hinton broth 2 (MHC-2, Merck, USA) for bacitracin susceptibility tests ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck) to stop the fixation reaction.
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck) and subsequently allowed to adhere on ICAM-1 coated glass slides before TOCCSL imaging ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck)) ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck). Cells were kept on ice or seeded onto ICAM-1-coated glass slides for imaging at 37°C and in TIRF mode ...