Labshake search
Citations for Merck :
451 - 500 of 4618 citations for 1 2 Chloropyridin 3 yl 3 3 dimethylazetidin 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... excess cisplatin and thiourea was removed by centrifugal filtration (Merck, Amicon® Ultra 3 kDa filters) at 14,000 rcf for 10 minutes at 4 °C ...
-
bioRxiv - Biophysics 2022Quote: ... Proteins were concentrated using a centrifugal filter unit (3 kDa MWCO, Merck Millipore; Cat. No. UFC900324) at 3500 rpm and 4°C ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... in absolute ethanol (Thermo-Fischer; order code AJA214-2.5LPL) and 3 mL of propionic acid (Merck, Pty Ltd. ...
-
bioRxiv - Plant Biology 2022Quote: ... and the protein was concentrated in a centrifugal concentrator (Amicon MWCO 3 kDa: Merck, Darmstadt, Germany) and stored at −20 °C in dialysis buffer (150 mM NaCl ...
-
bioRxiv - Microbiology 2022Quote: ... Supernatant was transferred to Amicon Ultra-0.5 Centrifugal Filter Unit 3 kDa (Merck Millipore cat # UFC500396) and centrifuged for 45 min at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... 3-10 mL of liquid culture was filtered through 0.2 um Polycarbonate (PC) membrane filters (Merck Millipore Ltd ...
-
bioRxiv - Cancer Biology 2023Quote: ... slides were blocked with 3% freshly made bovine serum albumin (BSA)/PBS buffer (Sigma-Aldrich/Merck). The antibody mix containing the individually diluted metal-conjugated antibodies in 0.5% BSA/PBS was applied to the slides ...
-
bioRxiv - Microbiology 2023Quote: ... We used sterile-filtered 3 % bovine serum albumin (BSA heat shock fraction, pH 7, > 98 %, Merck) in 1 × Pierce PBS buffer (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Bioengineering 2024Quote: ... We then dissolved 100 μmol of N-ethyl-N’-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC, Merck, E7750) in 1 mL of MES buffer and added it to the beaker ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein mixtures were incubated with 40μl PBST washed Streptavidin agarose resin (50% slurry, 69203-3 Merck) and incubated for 2h at room temperature on a roller ...
-
bioRxiv - Neuroscience 2024Quote: ... a group of approximately 50 flies in a training tube alternately received 3-octanol (3OCT; Merck) and 4-methylcyclohexanol (4MCH ...
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Bioengineering 2024Quote: ... and the elution fractions were concentrated with Amicon Ultra centrifugal filter units (3 kDa, UFC800324, Merck) to a concentration of 0.24 mg/mL (3.6 µM) ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by incubation with 200 µl of blocking solution [3% bovine serum albumin (BSA) (10735086001; Merck) in PBS-T at 37 °C for 1 h ...
-
bioRxiv - Biochemistry 2024Quote: ... The protein mixture was concentrated using Amicon Ultra 3 kDa MW cut-off device (Merck Millipore) to ∼15 mg/ml and used to set up commercial crystallisation screens using the sitting drop vapour diffusion method at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP (1:2000) (Faix et al., 2001) or mouse monoclonal antibody against glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:1000; #CB1001-500UG, Merck (Darmstadt, Germany)) and anti-fascin antibody 5E2 (undiluted hybridoma supernatant) ...
-
bioRxiv - Neuroscience 2023Quote: ... was dissolved in vehicle (Ringer solution; NaCl 140 mM, CaCl21.2 mM, KCl 3 mM and MgCl2 1 mM (Merck KGaA Darmstadt, Germany)) to a dilution of 5.5μg/μl ...
-
bioRxiv - Developmental Biology 2023Quote: ... the slides were rinsed three times with PBS and blocked for 1 hour at RT in blocking buffer made with 3% BSA (Merck Millipore, 0218072801) and 0.02% Triton X-100 (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... The tissue sections from the in vivo experiment were incubated with a rabbit primary antibody for GluR2/3 (Merck Millipore; AB1506; 1:200) overnight and then with a secondary goat anti-rabbit IgG (Cell Signaling Technology ...
-
bioRxiv - Plant Biology 2023Quote: ... The sections were then incubated for 1 h with 700 µL of a 10% (v/v) DMSO/3% (v/v) IGEPAL® CA-630 (Merck, Darmstadt, Germany) in MTSB ...
-
bioRxiv - Cancer Biology 2024Quote: ... The following day the membrane was washed with T-PBS (0.1% tween) (15 min x 3 times) and appropriate secondary antibody: (i) anti-rabbit antibody conjugated with peroxidase enzyme (Merck Sigma, Burlington, MA) was dissolved in 5% BSA in T-PBS (0.1% tween ...
-
bioRxiv - Developmental Biology 2020Quote: ... all other conditions: N=3) in the presene of 4µg/ml polybrene (cat. TR-1003-G, Merck) (Supplementary Figure 2) ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Cell Biology 2020Quote: ... and proteins were eluted using 100 µl of 150 ng/µl 3× FLAG Peptide (F4799, Merck KGaA) or HA peptide (HY-P0239 ...
-
bioRxiv - Neuroscience 2022Quote: ... animals were briefly anesthetized with isofluorane and 200nl of 3 nM clozapine-N-oxide (CNO, #C0832, Merck) was infused bilaterally via implanted cannulae in ACx using a Hamilton syringe (10 μl ...
-
bioRxiv - Cell Biology 2022Quote: Depletion of Cav1 was achieved by RNAi using siRNAs with the following sequence: 5’ GCAUCAACUUGCAGAAAGA 3’ (Merck), and Control siRNA Luciferase ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 mM MgCl2) using Amicon Ultra-0.5 mL Centrifugal Filters (30 or 100 K MWCO, Merck Millipore). After re-measuring the concentrations by densitometry ...
-
bioRxiv - Biochemistry 2020Quote: ... before Rab8a was washed 3 times with PBS in an Amicon filter (Merck Millipore, 10 kDa NMWL). Incorporation of label was confirmed by MS.
-
bioRxiv - Cancer Biology 2022Quote: ... and functionalized by 200 µl of a 3% (v/v) solution of hyaluronic acid (HA) (Merck, Germany) at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... Japan) with a Discovery HS F5 column (2.1 mm i.d. × 150 mm, 3 μm particle size, Merck) coupled with a LCMS-8060NX ...
-
bioRxiv - Microbiology 2021Quote: Full-length CA sequences derived from pNL4-3 was introduced to pET30a vectors (Novagen-Merck KGaA, Germany), producing a pET30a CA vector ...
-
bioRxiv - Immunology 2021Quote: ... Calu-3 cells were transduced by addition of lentiviral supernatants containing 8 μg/ml polybrene (Merck Darmstadt). 48 hours after transduction ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pH 7 using repetitive washing and centrifugation with an Amicon 3 kDa MWCO centrifugal filter (Merck Millipore). For the synthesis of ditopic A’-A’ CC ligand ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were washed with PBS and fixed for at least 3 h with 70% ethanol (Merck, 100983). Cells were washed with PBS and analyzed by using the Cell Cycle Kit (Luminex Corporation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was transferred to Amicon Ultra-0.5 Centrifugal Filter Unit 3 kDa (Merck Millipore catalogue no. UFC500396) and centrifuged for 45 min at 4 °C at 12,000g ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein-containing fractions were pooled and concentrated on an Amicon 3 kDa MWCO spin concentrator (Merck Millipore). After another IMAC purification step using Ni-NTA resin ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... The desired concentration was achieved using Amicon® Ultra centrifugal filter units (3 kDa cutoff – Merck Millipore).
-
bioRxiv - Immunology 2022Quote: ... for 1 hour at RT and washed 3 times with TBS/Tw (TBS containing 0.05% v/v Tween-20 (8.17072.1000, Merck)) ...
-
bioRxiv - Biochemistry 2022Quote: ... The aE11-Fab sample was concentrated by centrifugal concentrator with a MWCO of 3 kDa (Merck Millipore) and further purified by size exclusion chromatography into 20 mM Tris ...
-
bioRxiv - Cell Biology 2024Quote: ... they were washed four times for 3 minutes with PBS and mounted in Mowiol reagent (81381, Merck). The image acquisition was done on a Zeiss LSM880 confocal microscope running the software Zeiss ZEN2.3 SP1 FP3 (black ...
-
bioRxiv - Bioengineering 2023Quote: ... unreacted biotin-pentylamine was removed by ultrafiltration with a 3 or 10 kDa MWCO membrane (Merck Millipore). The recovered upper residual liquid (∼100 μL ...
-
bioRxiv - Systems Biology 2023Quote: ... Shimadzu) with a Discovery HS F5 column (2.1 mm i.d. × 150 mm, 3 μm particle size, Merck) coupled with a Q Exactive instrument (PFPP-LC/MS/MS) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The gelatinous sack surrounding the eggs was removed by incubation in 3% L-Cysteine (Merck Millipore, USA) while rotated by hand for 15 minutes ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μl of N,N,N’,N’-Tetramethylethylendiamine (TEMED, #612-103-00-3, Sigma-Aldrich now Merck) was added to 1 ml of the monomer solution ...
-
bioRxiv - Biochemistry 2022Quote: ... Shimadzu) with a Discovery HS F5 column (2.1 mm i.d. × 150 mm, 3 μm particle size, Merck) coupled with a Q Exactive instrument ...
-
bioRxiv - Biochemistry 2022Quote: ... # T7408) using an ultrafiltration cartridge (Amicon Ultra 0.5 mL 3 K; Merck, Readington, NJ, USA; Cat. # UFC500324). The total protein levels in the samples were assayed using the Pierce™ BCA Protein Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... by submersion in 160 mg/l MS-222 (ethyl 3-aminobenzoate methanesulfonate; Sigma-Aldrich, Merck, Darmstadt, Germany) dissolved in tank water ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The cell extracts were concentrated using Amicon Ultra-15 3 kDa cutoff (Merck Millipore, Burlington, MA, USA). The obtained cell extract was flash-frozen in liquid nitrogen and preserved at −80 °C until further use.
-
bioRxiv - Biophysics 2022Quote: ... and were dissolved in a mixture of chloroform / methanol (7:3 vol/vol, both from Merck KGaA) to yield four stock solutions at 1.5 mM lipid concentration ...