Labshake search
Citations for Merck :
5051 - 5100 of 5322 citations for 6 9 Methano 4 1 benzoxazepin 2 3H one octahydro 3 methyl 3 α 5a bta 6 bta 9 bta 9a bta 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... followed by 2h incubation with Alexa Fluor-488 goat anti-rabbit IgG secondary antibody (1:500, A11008, Merck Millipore, MA). Slices were transferred to glass slides and covered with Fluoromount (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were incubated with mouse monoclonal Alexa Fluor-488 conjugated antibody against NeuN (1:200, MAB377X, Merck Millipore, MA, USA) or the rabbit polyclonal primary antibody against DISC1 (1:250 ...
-
bioRxiv - Developmental Biology 2021Quote: ... They were incubated 1h at RT in a blocking buffer (20% BR + 20% goat serum) and then overnight with an anti-DIG-AP antibody (1:2000, Merck) in the blocking buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... LECs (1.5 × 105) were transfected with 25 pmol of target siRNA or non-target siRNA (MISSION siRNA universal control#1, Merck) using Lipofectamine RNAiMAX (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were transfected with MISSION® SiRNA oligomers or MISSION® siRNA Universal Negative Control #1 (Sigma Aldrich, Merck, USA) at a final concentration 20 nM ...
-
bioRxiv - Biochemistry 2022Quote: ... lysates were incubated with anti-HA agarose beads (20 μl of beads per 1 mg of proteins) (Merck, Darmstadt, Germany) for 2 h ...
-
bioRxiv - Immunology 2022Quote: Decidual cells were isolated as described above and incubated in the presence of fluorescence-labeled latex beads (50 beads per cell; latex beads, 1 µm, carboxylate-modified polystyrene, fluorescent yellow-green, Merck) for 2 hours at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were blocked for 30 min in 0.3 % Triton / 10 % normal goat serum / TBS followed by overnight primary antibody incubation (1:1000; rb TH; Merck Millipore) at 4 °C ...
-
bioRxiv - Genetics 2022Quote: ... Transient transfection was carried out in HEK293T cells transfected with 1 μg of plasmid DNA in the presence of X-tremeGene9 DNA transfection reagent (#6365809001, Merck), according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... individuals were placed in 0.008% alizarin red (alizarin red S monohydrate, Waldeck Chemie, Münster, Germany) and 1% potassium hydroxide (EMSURE, Merck, Darmstadt, Germany) for 24 h ...
-
bioRxiv - Immunology 2022Quote: ... the sections were treated with 10% methanol in PB for 20 min and then incubated for 1 h at RT in incubation buffer: 5% normal donkey serum (NDS: Merck) and 0.2% Triton X-100 (Merck ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 mL of filtered protein extract was mixed with 40μL of anti-FLAG M2 magnetic beads (Merck, formerly Sigma-Aldrich) (equilibrated in GTEN + 0.1 % Tween-20 prior to use ...
-
bioRxiv - Neuroscience 2022Quote: ... The dura was removed and a glass pipette connected to a Hamilton syringe containing LPC (1% in PBS; Merck, Germany) was lowered into the brain until 1.80 mm depth from the brain surface reaching into corpus callosum ...
-
bioRxiv - Molecular Biology 2022Quote: ... was assessed before and after induction with Doxycycline (1 μg/mL) by Western blot analysis using an anti-FANCJ (cat. B1310, Merck) and/or an anti-Flag antibody.
-
bioRxiv - Neuroscience 2022Quote: ... sections were mounted on slides and covered with an anti-fading medium using a mix solution 1:10 Propyl-gallate:Mowiol (P3130, SIGMA-Aldrich, Madrid, Spain; 475904, MERCK-Millipore ...
-
bioRxiv - Cancer Biology 2022Quote: ... were sonicated in 1 M KOH solution (6592-3705, Daejung) for 30 min and then washed with Milli-Q water (Direct 8, Merck) to remove remaining KOH solution ...
-
bioRxiv - Microbiology 2022Quote: ... wells were washed twice with warm PBS before incubation in 500 μL pre- warmed DMEM with 1% (v/v) Nutridoma (Merck) supplemented with 5 μM clickable sphingosine (Cayman Chemical ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were washed with 1% BSA/PBS and subjected to the Click-iT reaction in a solution containing 10 mM sodium ascorbate (Merck), 0.1 mM azide-PEG3-biotin conjugate (Merck ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting cell pellet was freeze-thawed thrice and re-suspended to 10% (w/v) in a lysis buffer containing 5% (v/v) Polysorbate 80 and 20 U mL−1 benzonase (Merck). After 1 h incubation at 37 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... The lyophilized peptides were resolubilized in 80 % acetone with 1 % TFA and loaded onto an ihouse ZIC-HILIC micro-column containing 30 mg of ZIC-HILIC particles (Merck Millipore ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated in T cell medium for 30 min at 37°C without any metabolic inhibitors or in presence of 1 μM oligomycin (Merck), 100 mM 2DG (Merck) ...
-
bioRxiv - Cell Biology 2024Quote: ... Secondary antibodies (table 1) were added in 5% milk TBS-T and membranes were developed using ECL luminol kit (Merck) and chemiluminescence films (Amersham Hyperfilm ECL ...
-
bioRxiv - Neuroscience 2024Quote: ... Three baseline recordings were taken followed by three recordings after each of the following subsequent injections: 1 μM Oligomycin (Merck), 1 μM FCCP (Merck ...
-
bioRxiv - Neuroscience 2024Quote: ... For the expression of short hairpin RNA (shRNA) we used lentiviral plasmids pLKO.1-ATF4 for ATF4 (TRCN0000301721) with the target sequence: CGGACAAAGATACCTTCGAGT (#SHCLND, Merck) and for non-targeting controls a pLKO.1-plasmid encoding a scrambled sequence (shNTC) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Buffer was exchanged for 1× DPBS and LNPs were concentrated by centrifugation on Amicon 50 kDa filter unit (Merck #UFC805024). Size distribution and polydispersity index were determined using dynamic light scattering on Zetasizer Ultra Red (Malvern ...
-
Insight into the regulatory mechanism of the MFS transporter, SCO4121 by the MarR regulator, SCO4122bioRxiv - Molecular Biology 2024Quote: ... the MSA agar plate was flooded and 500 µg/ml of nalidixic acid (Himedia) and 1 mg/ml of apramycin (Merck). After incubation ...
-
bioRxiv - Microbiology 2024Quote: ... the A549 cells were washed once with 1× phosphate-buffered saline (PBS) before incubating again with 100 µL of 0.5 mg/mL of MTT reagent (Merck, Germany) for 3 h at 37°C to allow the formation of purple formazan ...
-
bioRxiv - Microbiology 2024Quote: ... The pellet was resuspended in RNA solubilization buffer (20 mM dithiothreitol (Vivantis, Malaysia) and 1 mM sodium citrate (Merck, Germany). The yield and purity were determined with a BioDrop Spectrophotometer Duo (Biochrom ...
-
bioRxiv - Cell Biology 2024Quote: ... and Pb external calibrations were prepared from 1 g/L stock solutions (Carl Roth, Centipur® Merck, or VHG Labs). Se was quantified by isotope dilution analysis (IDA ...
-
bioRxiv - Microbiology 2023Quote: ... Fractions corresponding to CVB5 were combined and concentrated to 4.5 mg ml-1 using Amicon Ultra centrifugal filter units with 100 kDa MWCO (Merck Millipore).
-
bioRxiv - Neuroscience 2023Quote: ... Plates were washed three times with 0.1% PBST and incubated at RT for 1 hour with horseradish peroxidase-conjugated secondary antibody (Cat No. NA934, Merck Millipore) diluted 1:1,000 in 0.05% PBST ...
-
bioRxiv - Neuroscience 2022Quote: ... whole plasmids (Entry plasmids containing cmk-1 coding DNA sequences) were amplified with the KOD Hot Start DNA Polymerase (Novagen, Merck). Primers were phosphorylated in 5’ and were designed to contain the desired point mutation(s ...
-
bioRxiv - Microbiology 2023Quote: ... binding of equine antibodies was detected by incubation for 1 hour with protein A conjugated to peroxidase (GE) and visualized with chemiluminescence reagent (ECL, Merck). Images were obtained with an Odyssey LI-COR instrument ...
-
bioRxiv - Cell Biology 2023Quote: ... APTS-labelled glycans were prepared for xCGE-LIF in a 1:10 dilution in water (water for chromatography, LC-MS grade, Merck) and mixed with 1 µl GeneScan™ 500 LIZ™ dye Size Standard (1:50 dilution in HiDi™ Formamide ...
-
bioRxiv - Biochemistry 2023Quote: ... Peak fractions were concentrated to 2.2 mg mL-1 using 100 kDa molecular weight cut-off centrifugal filters (Merck Millipore). To each 300-mesh holey carbon grid (Au R1.2/1.3 ...
-
bioRxiv - Evolutionary Biology 2023Quote: The frozen cell pellet was homogenized in RIPA buffer (Fujifilm, Osaka, Japan) containing 1/100 (v/v) in a final volume of Protease Inhibitor Cocktail (Merck) for 30 min at 4 °C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Japan) in 1× PBS for 20 min at room temperature and then incubated with the anti-ADAR antibody HPA051519 (Merck) diluted 1:200 with PBS for 12 h at 37 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... The pre-adipocytes were plated in custom-made plates (Supp. Fig. 15b) and cultured in growth medium -low glucose (1g l-1) DMEM (Merck) supplemented with 10% FBS (Merck) ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were incubated for 1 h at RT with a mouse anti-2A primary antibody (cat. no. MABS2005, Merck) diluted 1:2000 in 1% (w/v ...
-
bioRxiv - Cell Biology 2023Quote: Proximity ligation assays with Aurora A kinase and MP-GAP were performed in HeLa cells using mouse anti-Aurora A Kinase antibody (1:500, A1231 Merck), rabbit anti-MP-GAP antibody (1:250 ...
-
bioRxiv - Microbiology 2023Quote: ... Hydrophobic surface treatment was performed after bonding by flushing with 1% (v/v) trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Merck) in HFE-7500 and ...
-
bioRxiv - Immunology 2023Quote: ... were transduced with respective CORA receptors in a multiplicities of infections (MOI) of 1 and 5 μg/mL Polybrene (Merck). Cells harboring the receptor were enriched by using biotinylated anti-EGFR antibody and anti-biotin microbeads (Miltenyi Biotec).
-
bioRxiv - Immunology 2023Quote: CORA receptors were transduced into a previously described Jurkat-based reporter cell line (12) by addition of lentiviral particles in a MOI of 1 and 5 μg/mL Polybrene (Merck) using spinoculation ...
-
Neural mechanisms underlying uninstructed orofacial movements during reward-based learning behaviorsbioRxiv - Neuroscience 2023Quote: ... the slices were washed three times with a blocking buffer containing 1% bovine serum albumin and 0.25% Triton-X in phosphate buffer saline (PBS) and then incubated with primary antibodies (anti-tyrosine hydroxylase, rabbit polyclonal, 1:1000, Merck Millipore ...
-
bioRxiv - Microbiology 2023Quote: ... 1[µg of total RNA from each of three independent experiments was digested with DNase I (Merck Ltd. Budapest, Hungary) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were then washed three times with 1 x PBS and mounted using an antifade mounting media (Sigma-Aldrich/Merck). The images were captured using a Zeiss AXIO Observer.Z1 Inverted Fluorescence microscope (Zeiss) ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were lysed in RIPA buffer supplemented with protease and phosphatase inhibitor cocktail and 1 μM PARG inhibitor ADP-HPD (Merck). For chromatin fraction ...
-
bioRxiv - Biophysics 2023Quote: ... and was subsequently concentrated to 1 mL using a 100 kDa cut-off Amicon ultra centrifugal filter (Merck Millipore, Germany). The concentrated protein sample was further purified by size exclusion chromatography (SEC ...
-
bioRxiv - Developmental Biology 2023Quote: ... Haematoxylin and Eosin staining was performed on few ST muscle sections by incubating the slides at RT for 1 min in hematoxylin solution (Merck). Slides were then washed for 10 min in running tap water before incubating for 1 min in eosin solution (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2023Quote: ... Cells were then acquired on the flow cytometer for ~25 seconds before the addition of 1 μg/mL ionomycin (Merck), and calcium flux was measured for ~1.5 mins.