Labshake search
Citations for Biotek :
901 - 950 of 5651 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... OD600) was measured every 10 minutes for up to 24 hours in a BioTek Eon Microplate spectrophotometer (BioTek, Winooski, VT, USA). For phenotypic growth screens ...
-
bioRxiv - Microbiology 2024Quote: ... with a gain of 120 and readings were performed in a Synergy HTX multi-mode plate reader with the 3.10.6 version of the Gen5 Microplate Reader and Imager Software (BioTek, Winooski, VT). Reported data represent fluorescence readings (expressed in Relative Fluorescence Units ...
-
bioRxiv - Microbiology 2024Quote: ... The acrtivity of purified PBP2a was measured spectrophotometrically (Cytation 3, BioTek) in potassium phosphate buffer (PBS ...
-
bioRxiv - Microbiology 2024Quote: DNA was extracted from 200µL aliquots of individual samples using the EZNA Bacterial DNA Kit (Omega Biotek, Norcross, GA, USA) with some modifications ...
-
bioRxiv - Microbiology 2024Quote: ... Luminescence reading was measured using a Synergy BioTek multi-mode plate reader (BioTek Instruments, Inc.), 0.1% DMSO-treated cells were included as positive control ...
-
bioRxiv - Microbiology 2024Quote: ... The extracted RNA was re-suspended in 30 μl RNase-free water then quantified with a BioTek Synergy™2 Multi-detection Microplate Reader (BioTek Instruments, Winooski, VT) and agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2024Quote: ... except that samples were visualized on a Cytation 5 (BioTek), and analysis was performed using the system’s automated software [12].
-
bioRxiv - Neuroscience 2024Quote: ... 4MU fluorescence was measured using a Cytation 5 plate reader (BioTek) (excitation ...
-
bioRxiv - Synthetic Biology 2024Quote: ... either a Synergy 4 multimode microplate reader (BioTek Instruments Inc.), an Infinite 200Pro microplate reader (Tecan Trading AG) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The intensity of the color is inversely proportional to the amount of ecdysteroid present as determined by spectrophotometry on a μQuant Microplate Spectrophotometer plate reader at 410 nm (BioTek Instruments, Vermont). The kit solutions were resuspended in UltraPure water (Cayman Chemical) ...
-
bioRxiv - Neuroscience 2024Quote: ... Calcium transients were recorded at day 10 using a Cytation 10 confocal imaging system (Agilent BioTek) with a 0.08 s sampling rate for neuronal recordings and 0.13 s sampling rate for BMEC recordings ...
-
bioRxiv - Neuroscience 2024Quote: ... and z-projections generated for maximum intensities (Agilent BioTek). Z-projections were input into Image J ...
-
bioRxiv - Bioengineering 2024Quote: ... and fluorescence emission was measured at 590 nm (Cytation5, BioTek) and at 580-640nm (Glomax ...
-
bioRxiv - Neuroscience 2024Quote: ... Absorbance was measured immediately at 450nm using a microplate reader (BioTek Instruments Inc).
-
bioRxiv - Cell Biology 2024Quote: ... DAPI-stained nuclei were counted in whole well images captured by Cytation 5 instrument (BioTek Instruments, Inc) using Gen5 Image Plus (version 3.10 ...
-
bioRxiv - Bioengineering 2024Quote: ... the fluorescence of each well was recorded with a plate reader (Synergy H4 Hybrid Microplate Reader, Agilent BioTek) with an excitation wavelength of 560 nm and emission at 590 nm ...
-
bioRxiv - Neuroscience 2024Quote: ... Fluorescenc was measured at 550nmex/620nmem (BioTek, USA) and normalized.
-
bioRxiv - Plant Biology 2024Quote: ... for 2 h and analyzed with an optical density plate reader (plate reader Biotek Epoch2 ...
-
bioRxiv - Neuroscience 2024Quote: ... After 40 hours post-transfection, cells were fixed in 4% PFA, and images (eGFP, mCherry, and eBFP2) were acquired using cytationC10 (Biotek) with a 20x objective ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The measurements were performed utilizing a Synergy Neo2 plate reader (Biotek), operated with the Gen5 software (version 2.09) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The fluorescence signal was read in a Synergy H1 microplate reader (BioTek, Winooski, Vermont, EUA). Results were expressed as the percentage of metabolic inhibition compared to the control (cells without treatment) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Absorbance was measured using Synergy H1 Hybrid Multi-Mode plate reader (BioTek Instruments, Winooski, VT).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Experiments in Figure 2 were performed on a Synergy H4 platereader (Gen5 v.2.05, Biotek). All other experiments were performed on a Tecan Spark platereader ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Absorption was measured at 450 nm using an ELx808 Absorbance Microplate Reader (BioTek Instruments ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The absorbance at 570nm was measured in a spectrophotometer (BioTek, Synergy H1).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Spectrophotometry was performed to measure absorbance at 460nm (BioTek, Synergy H1). All the experiments and replicas were further used to calculate the standard error mean (SEM) ...
-
bioRxiv - Neuroscience 2024Quote: ... Immunofluorescent staining was automated using an EL406 plate washer and dispenser (Biotek).
-
bioRxiv - Neuroscience 2024Quote: ... The resulting supernatant was then separated and stored at -80°C for further colorimetric measurements with a microplate reader (BioTek Synergy H1, Agilent, USA).
-
bioRxiv - Neuroscience 2024Quote: ... plates gently shaken for thorough homogenization and incubated for 24 h in standard culture conditions in the Cytation 5 Cell Imaging Multi-mode Reader (BioTek; CAPI – ICB, UFMG, Brazil). Four equally spaced image sets (bright field and RFP channels ...
-
bioRxiv - Neuroscience 2024Quote: ... wavelength fluorescent values were read at 10 minute intervals for 80 minutes total using a Synergy Neo2 microplate Reader (BioTek). Migration index was calculated by subtracting the fluorescence values of the vehicle well from the paired well containing C5a chemoattractant ...
-
bioRxiv - Neuroscience 2024Quote: ... The reactions were started by the addition of kinase to the reaction mix and the NADH fluorescence was measured using a Synergy H1 microplate reader (Biotek) at 450 nm at 30°C for 10 min with 20 sec intervals ...
-
bioRxiv - Neuroscience 2024Quote: ... was added to each well and after 2 hours in the incubator absorbance was measured using a microplate reader (BioTek, Synergy HT ...
-
bioRxiv - Immunology 2024Quote: ... The optical density of the wells was then read using a 450/630 nm setting of a ELx808 plate reader (BioTek). The raw optical density (OD ...
-
bioRxiv - Immunology 2024Quote: ... was collected from mice by inserting an 18 G catheter into the trachea and flushing the lungs twice with 750 µL 1X PBS each time (1.5 mL total) and fluorescence (Ex/Em 482/525) quantified on a plate reader (Biotek Synergy).
-
bioRxiv - Immunology 2024Quote: ... The dye concentration in the supernatant was then quantified on a plate reader (Biotek Synergy) at an absorbance of 620 nm and quantified by comparing to a standard curve ...
-
bioRxiv - Neuroscience 2024Quote: ... Relative quantification of calcium levels was determined by ratiometric quantification of fluorescent intensity following excitation at 340nm and 380nm and detection at 510nm on a Synergy H1 microplate reader (BioTek). After baseline measurements ...
-
bioRxiv - Synthetic Biology 2024Quote: Performance of muGFP variants were quantified by measuring fluorescence on a plate reader (BioTek Synergy H1) using an excitation of 485 nm and emission of 528 nm ...
-
bioRxiv - Biochemistry 2024Quote: ... and luminescence measurements were taken at room temperature with a SYNERGY2 microplate reader (BioTek) in black opaque 384-well microplates ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 200 µL of each culture was transferred to a flat-bottom 96-well plate for measurement with a Synergy H1 microplate reader (BioTek Instruments, Inc.). Growth rates were calculated with the following equation: ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and the plate incubated overnight in a plate-reader (Biotek Synergy HTX) at 37 °C ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cells were diluted 100x from overnight cultures and re-grown in a 96-well plate (200 µL per well) in a plate-reader (Biotek Synergy HTX) until they reached an OD600 of 0.2 to 0.3 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... OD600 readings were recorded every 5 minutes for 30 hours at 30 °C using a microplate reader (Biotek, SYNERGY H1), which included a 10-second shake before each measurement ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plates were incubated and measured in a Synergy HT Microplate Reader (Biotek) shaking at 30°C ...
-
bioRxiv - Neuroscience 2024Quote: ... Genomic DNA concentrations were determined using the Synergy 2 Plate Reader (BioTek). CAG repeat-spanning HTT PCR products from both the HttQ111/+ and HttLacO-Q140 cohorts were amplified from genomic DNA using 6-FAM-labeled CAG1 forward primer (5’ ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC 3’ ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... the absorbance at 450 nm was measured with a microplate reader (BioTek Synergy H1).
-
bioRxiv - Physiology 2024Quote: ... and spectrophotometer (Agilent Biotek Synergy H1 hybrid reader ...
-
bioRxiv - Plant Biology 2024Quote: Total RNA was extracted from 4-week-old Arabidopsis plants via a Plant RNA Kit (OMEGA Biotek, Norcross, USA). cDNA was synthesized via ReverTra Ace® qPCR RT Master Mix with gDNA Remover (TOYOBO) ...
-
bioRxiv - Physiology 2024Quote: ... Fluorescence was measured at room temperature using a Cytation 5 Imaging Multi-Mode Reader (BioTek) with excitation and emission wavelengths at 400 and 505 nm ...
-
bioRxiv - Physiology 2024Quote: ... The final colour change reaction was measured at 450 nm using a Synergy HT microplate reader (Biotek, Vermont, USA). GraphPad Prism software version 9.5.1 for Windows (GraphPad ...
-
bioRxiv - Microbiology 2024Quote: ... Growth was monitored by measuring A600 every 15min (Epoch 2 or SynergyMx, (Biotek) plate readers) ...