Labshake search
Citations for Biotek :
751 - 800 of 5651 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... the biofilms were stained with 0.1% crystal violet and OD590 was measured using a microplate plate reader (Cytation 3, BioTek or Clariostar) (23) ...
-
bioRxiv - Microbiology 2024Quote: ... OD600 of strains were measured at 15-min intervals over 20 hours using a microplate reader (BioTek).
-
bioRxiv - Microbiology 2024Quote: ... and the absorbance was recorded at 570 nm using a microplate reader (Biotek synergy H1).
-
bioRxiv - Immunology 2024Quote: ... was collected from mice by inserting an 18 G catheter into the trachea and flushing the lungs twice with 750 µL 1X PBS each time (1.5 mL total) and fluorescence (Ex/Em 482/525) quantified on a plate reader (Biotek Synergy).
-
bioRxiv - Immunology 2024Quote: ... The dye concentration in the supernatant was then quantified on a plate reader (Biotek Synergy) at an absorbance of 620 nm and quantified by comparing to a standard curve ...
-
bioRxiv - Neuroscience 2024Quote: ... Genomic DNA concentrations were determined using the Synergy 2 Plate Reader (BioTek). CAG repeat-spanning HTT PCR products from both the HttQ111/+ and HttLacO-Q140 cohorts were amplified from genomic DNA using 6-FAM-labeled CAG1 forward primer (5’ ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC 3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... wavelength fluorescent values were read at 10 minute intervals for 80 minutes total using a Synergy Neo2 microplate Reader (BioTek). Migration index was calculated by subtracting the fluorescence values of the vehicle well from the paired well containing C5a chemoattractant ...
-
bioRxiv - Neuroscience 2024Quote: ... The reactions were started by the addition of kinase to the reaction mix and the NADH fluorescence was measured using a Synergy H1 microplate reader (Biotek) at 450 nm at 30°C for 10 min with 20 sec intervals ...
-
bioRxiv - Neuroscience 2024Quote: ... was added to each well and after 2 hours in the incubator absorbance was measured using a microplate reader (BioTek, Synergy HT ...
-
bioRxiv - Immunology 2024Quote: ... The optical density of the wells was then read using a 450/630 nm setting of a ELx808 plate reader (BioTek). The raw optical density (OD ...
-
bioRxiv - Microbiology 2024Quote: ... Absorbance was read at 575 nm on a microplate reader (Synergy HT, Biotek/Agilent Systems) using Gen 5 software ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria grown in 96-well plates were incubated in a multiplate reader (LogPhase 600 from BioTek; Santa Clara, CA, USA) at 37°C for 16 hrs ...
-
bioRxiv - Microbiology 2024Quote: ... Purified RNA was quantified using a Nanodrop spectrophotometer (BioTek Epoch Microplate Spectrophotometer ...
-
bioRxiv - Microbiology 2024Quote: Exponential phase cells were diluted to an OD600 of 0.125 (OD600 obtained on a BioTek Synergy plate reader in a 96 well plate) ...
-
bioRxiv - Microbiology 2024Quote: Exponential phase cells were diluted to an OD600 of 0.125 (OD600 obtained on a BioTek Synergy plate reader in a 96 well plate) ...
-
bioRxiv - Microbiology 2024Quote: Exponential phase cells were diluted to an OD600 of 0.015 (OD600 obtained on a BioTek Synergy 96 well plate) in ATGN ...
-
bioRxiv - Microbiology 2024Quote: ... Growth and promoter fusion expression was followed by microplate reader (BioTek Synergy HTX Multi-mode Microplate Reader) ...
-
bioRxiv - Microbiology 2024Quote: ... The bacterial growth of the different strains was monitored every 10 min for 24 h using a Synergy H1 plate reader (BioTek, USA). Three independent replicates were performed ...
-
bioRxiv - Microbiology 2024Quote: ... Absorbance readings were taken at 405 nm using a Synergy H4 microplate reader (BioTek, Winooski, VT), with results expressed as raw optical density (OD ...
-
bioRxiv - Microbiology 2024Quote: ... To quantify luciferase activity the plates were placed in the Synergy H1 multimode microplate reader (BioTek, North Macedonia) at 37°C with stirring ...
-
bioRxiv - Microbiology 2024Quote: ... Cultivation was performed in Synergy XHT multi-mode reader (Biotek Instruments, Winooski, VT, US), at 30°C with orbital continuous shaking (3 mm) ...
-
bioRxiv - Microbiology 2024Quote: ... emission at 640 nm was measured with the multiplate reader SYNERGY HT (Biotek®).
-
bioRxiv - Microbiology 2024Quote: ... The OD600 of the samples was measured to assess regrowth using a microplate reader (BioTek Synergy H1) after 6 h for UPEC and 8 h for P ...
-
bioRxiv - Microbiology 2024Quote: ... OD600 and mScarlet fluorescence were recorded using a microplate reader (BioTek Synergy H1).
-
bioRxiv - Microbiology 2024Quote: ... The plate was incubated in a microplate reader (BioTek Synergy H1) at 37°C with continuous shaking for 20 h ...
-
bioRxiv - Immunology 2024Quote: ... Peptide loading was determined by fluorescence quantification using a modified fluorescamine peptide quantification assay in the presence of ACN (Ex/Em: 390/465 nm, Biotek Cytation 5)104.
-
bioRxiv - Microbiology 2024Quote: ... The RNA was quantified with an Eon microplate spectrophotometer (BioTek, Winooski, VT, USA) and treated with the Turbo DNase kit (Thermo Fisher ...
-
bioRxiv - Microbiology 2024Quote: ... incubated at 30 °C for 65 h (BioTek Synergy Neo2) and OD600 was measured every 1 h ...
-
bioRxiv - Immunology 2024Quote: ... Plates were developed for 10 minutes at room temperature and then the reaction was stopped by adding 50 μL 3 M hydrochloric acid (HCl, Fisher) and plates were read using a Synergy 4 (BioTek) plate reader at an optical density (OD ...
-
bioRxiv - Plant Biology 2024Quote: ... and incubated at 27°C in the Synergy H1 microplate reader (Biotek). The OD600 of the plates was measured every 30 min for 20 h ...
-
bioRxiv - Synthetic Biology 2024Quote: ... fluorescence was read with a SynergyTM HTX multi-mode microplate reader (BioTek, Winooski, VT, USA), with the filter having excitation and emission wavelengths at 485 nm and 528 nm ...
-
bioRxiv - Plant Biology 2024Quote: ... and the absorbances of 665 nm and 649 nm were measured by a BioTek Epoch Microplate Spectrophotometer (BioTek, Santa Clara, CA). Total chlorophyll content was calculated as follows ...
-
bioRxiv - Microbiology 2024Quote: ... and OD600 was measured every 10 min to acquire growth curves (either in a Biotek Synergy HT or Biotek synergy H1). Note that the OD600 values presented throughout all figures are from a microplate reader and were not pathlength-corrected.
-
bioRxiv - Immunology 2024Quote: ... The NO concentration was determined by measuring samples at 540 nm using a Synergy® microplate reader (Biotek, Berlin, Germany) within 30 min.
-
bioRxiv - Immunology 2024Quote: ... Plates were incubated at 25°C for 1 h then washed 3× in TBST using a plate washer (BioTek). Plates were blocked with 200 μL of 5% non-fat milk in TBST for 1 h at 25°C ...
-
bioRxiv - Immunology 2024Quote: ... Plates were incubated at 25°C for 1 h then washed 3× using a plate washer (BioTek). Plates were blocked with 200 μL of 5% non-fat milk in TBST (25 mM Tris (pH 8.0) ...
-
bioRxiv - Microbiology 2024Quote: ... and OD600 was measured every 10 min to acquire growth curves (either in a Biotek Synergy HT or Biotek synergy H1). Note that the OD600 values presented throughout all figures are from a microplate reader and were not pathlength-corrected.
-
bioRxiv - Neuroscience 2024Quote: ... The RNA concentration and purity were measured by absorbance (260/280 ratio) using a Take3 Micro-Volume Plate Reader (Biotek Instruments, Winooski, VT).
-
bioRxiv - Plant Biology 2024Quote: ... Soil NH + and NO3- concentrations were analyzed in extracts from 20 g soil mixed with 80 mL 0.5M K2SO4 solution (1:4, soil: 0.5M K2SO4 solution) and measured calorimetrically at 650 nm on a µQuant microplate reader (BioTek, Winooski, VT, USA) following Sims et al ...
-
bioRxiv - Physiology 2024Quote: ... The increase in absorbance at 412 nm was monitored over time using a microplate reader (PowerWave XS 2, BioTek Instruments, Winooski, VT, USA). This increase in absorbance indicates the formation of thionitrobenzoic acid ...
-
bioRxiv - Physiology 2024Quote: ... BUN was analyzed using an enzyme-labeled detector (Epoch, BioTeK, Winooski, USA), and ALT was measured using an automatic biochemistry analyzer (Chemray 800 ...
-
bioRxiv - Physiology 2024Quote: ... The quantity and quality of the samples were determined using the Cytation 5 (BioTek) plate reader and Agilent 4150 Tape Station System ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting fluorescence was measured using a fluorescent microplate reader at 530nmex/590nmem (BioTek, USA). Fluorescent readings were normalized to total protein ...
-
bioRxiv - Genetics 2024Quote: ... and read on an integrated Synergy HT plate reader (BioTek). Non-mycoplasma contamination was assessed via incubation of supernatant media ...
-
bioRxiv - Genomics 2024Quote: ... Absorbance was measured at 450 nm using a Synergy HTX Multi-mode Microplate Reader (BioTek Instruments, Winooski, VT, USA).
-
bioRxiv - Physiology 2024Quote: ... Luminescence was recorded on a Synergy H1 microplate reader (BioTek) and values during the mid-linear phase of the reaction were selected for analysis and normalized to total protein amount.
-
bioRxiv - Neuroscience 2024Quote: ... RNA concentration was determined by measuring OD260 nm absorbance in a Synergy HTX reader (Biotek).
-
bioRxiv - Neuroscience 2024Quote: ... the fluorescence of each sample was measured using a fluorescence spectrometer (Biotek instrument -Synergy HT).
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting luciferase values were read on a Synergy HTX plate reader (BioTek). Raw luciferase assay data for all experiments can be found in Table 3.
-
bioRxiv - Molecular Biology 2024Quote: ... Enzymatic reaction was initiated with the addition of fluorogenic substrate peptide at a concentration of 1.5 μM and the fluorescence signals were monitored continuously using a plate reader (Synergy HT, BioTek Instruments, Inc) with filters for excitation at 360/40 nm and emission at 460/40 nm for 30 min ...