Labshake search
Citations for R&D Systems :
4051 - 4100 of 4407 citations for Human Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: In vitro PARP1 activity was measured using the HT Universal Colorimetric PARP assay kit (R&D Systems cat# 4677-096-K) and PARP2 activity was measured using the PARP2 colorimetric assay kit (BPS Bioscience cat# 80581 ...
-
bioRxiv - Immunology 2022Quote: ... The expression of angiogenesis-related proteins was detected by using the Proteome Profiler Mouse Angiogenesis Array Kit (ARY015; R&D Systems) following the manufacturer’s protocols ...
-
bioRxiv - Neuroscience 2023Quote: The cytokine profile was analysed according to the manufacturer’s instructions (Mouse Cytokine Array Panel A Kit, R&D Systems, Catalogue #: ARY006). In these assays ...
-
bioRxiv - Cell Biology 2023Quote: ... and the medium in the basal chamber was collected and stored at −80 °C until cytokine profiling using a kit following manufacture’s’ protocol (Cat# ARY022B, R&D Systems). At the end of infection experiments ...
-
bioRxiv - Immunology 2024Quote: ... Cells were maintained at 37°C in a 5% CO2 atmosphere and tested regularly for mycoplasma contamination with a MycoProbe Mycoplasma Detection Kit following the manufacturer’s instructions (R&D Systems). Cell cultures were passaged no more than 15 times ...
-
bioRxiv - Cell Biology 2020Quote: ... mOSE cells were plated 24hrs prior to the addition of TGFB1 (10ng/mL, R&D Systems) and cells were collected after 4 days of treatment ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were incubated over night at 4 °C with the anti-CD140a (R&D Systems AF1062) diluted 1:80 in blocking solution ...
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Neuroscience 2020Quote: ... cell media included RPMI-1640 Glutamax (Life-Technologies) supplemented with 10% FBS (R&D Systems/biotechne), 1% penicillin/streptomycin (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated with an anti-Nluc antibody (R&D systems, MAB100261-SP, mouse, 1:500) in 1 % BSA/DPBS for 1 h at 4 °C ...
-
bioRxiv - Immunology 2022Quote: ... cells were cultured with Areg (R&D Systems, #989-AR-100, 10 or 100 ng/ml) or heptelidic acid (Adipogen ...
-
bioRxiv - Immunology 2022Quote: ... Non-pathogenic Th17 cell differentiation was performed with IL-6 (25 ng/mL, R&D Systems) and TGF-β1 (2 ng/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... HEK 293T cells were seeded on plates coated with Cultrex Poly-L-Lysine (R&D Systems) prior to transfection with the pCCl-c-MNDU3 STEAP1-BBζ CAR lentiviral plasmid and the packaging plasmids pMDL ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were changed into fresh media supplemented with DMSO or 600ng/mL IFNγ (R&D Systems) and incubated for 48 hours ...
-
bioRxiv - Immunology 2021Quote: ... the INS-1 cells were treated with recombinant mouse IFNγ (1000 units/mL; R&D Systems) and recombinant human IL-1β (50 units/mL ...
-
bioRxiv - Neuroscience 2020Quote: Mouse myelogenous leukemia (M-NFS-60) cells were M-CSF (R&D systems, 216-MC/CF) starved for 24 hours ...
-
bioRxiv - Neuroscience 2021Quote: ... Sox2 was used as a neuronal stem cell marker (mouse, MAB2018, R&D Systems, 1:100), Tuj1 (mouse ...
-
bioRxiv - Microbiology 2020Quote: ... Cells or organoids were stimulated with IFN-α2 (500 U/ml, R&D systems 11100-1), IFN-β (500 U/ml ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were then fixed and immunolabeled using goat anti-Lumican (R&D Systems, AF2745, 1:200) and donkey anti-goat IgG Alexa555 (Invitrogen ...
-
bioRxiv - Pathology 2021Quote: ... the cells were incubated with an anti-myosin heavy chain (MHC) (#MAB4470, R&D Systems,MN) (1:100 ...
-
bioRxiv - Microbiology 2021Quote: ... The cells were stimulated with increasing amounts of IFNs (α2 (R&D Systems, Cat#11101-2), β (R&D Systems ...
-
bioRxiv - Cell Biology 2021Quote: ... placental cell clusters were pretreated for 30 min with anti-NRP1 mAb (R&D Systems, AF3870) or anti-ACE2 mAb (Agilent ...
-
bioRxiv - Immunology 2021Quote: ... Th0 cell cultures were provided IL-2 (15 U/mL; R&D Systems 202-IL-500), while Th17 cell cultures were supplemented with IL-6 (20 ng/mL ...
-
bioRxiv - Immunology 2021Quote: ... Cells were treated with 10 ng/ml recombinant mouse TNFα (410-TRNC-010, R&D Systems) diluted in the media as described above.
-
bioRxiv - Microbiology 2020Quote: ... Detached cells were labelled with a mouse anti-ACE2 antibody (R&D Systems, Minneapolis, MN1/200) followed by an Alexa488 goat anti-mouse (1:1,000 ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were transferred to a new plate with fresh medium and IL-23 (R&D Systems). After 48 hours rest ...
-
bioRxiv - Cell Biology 2022Quote: ... specifically: goat anti-mouse platelet-endothelial cell adhesion molecule-1 (PECAM-1)/CD31 (R&D Systems), mouse anti-mouse α-smooth muscle actin (αSMA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells in PBS were mixed 1:1 with Cultrex TM (R&D systems, Minneapolis, MN, USA) at a final concentration of 1 x 106 in 100 μl prior to injection ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell pellets were resuspended in 70% basement membrane extract (BME) (R&D Systems, #3533-010-02). Each droplet of cell clusters contained roughly ∼2,000 cells/ 50uL ...
-
bioRxiv - Immunology 2023Quote: ... The cell monolayer was then stimulated with 6.25U/mL IL-1β (R&D systems, Minneapolis, MN) for 4h at RT to upregulate E-selectin ...
-
bioRxiv - Cell Biology 2023Quote: ... single cell suspensions were stained with a goat anti-galectin-9 antibody (AF2045, R&D systems) at 40 μg/ml or isotype control as negative control for 30 min at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell lysates were then incubated with 2 μg of anti-galectin-9 (AF2545, R&D systems) or isotype control under rotation ...
-
bioRxiv - Cell Biology 2023Quote: ... Those cells were washed and subsequently resuspended in Cultrex BME (Cat. No. 343300501, R&D Systems) and plated in 20-25 µl droplets of Cultrex ...
-
bioRxiv - Immunology 2023Quote: ... single cell suspensions were stained with a goat anti-galectin-9 antibody (AF2045, R&D systems) at 8 μg/ml or isotype control as negative control for 30 min at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were treated with or without 10 ng/ml TGFβ (R&D Systems, Cat. # 240-B) for another 24 hr and harvested for RNA extraction after 72 hr.
-
bioRxiv - Microbiology 2024Quote: ... further cells were treated with 1000 U IFN-β (R&D Systems, #8499-IF-010/CF). 24 h post-treatment whole-cell lysates for SDS-PAGE and immunoblotting were prepared.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The transfected HTLA cells were split into a poly-L-lysine (R&D systems, Minneapolis, MN) coated 96-well white clear bottom cell culture plates (Greiner Bio-One ...
-
bioRxiv - Cell Biology 2024Quote: ... FL5.12 cells were cultured in the presence of 10 ng/ml IL-3 (R&D Systems). Cell cycle exit in FL5.12 was achieved by washing the cells three times with PBS to remove IL-3 from the cells and by placing the cells in IL-3 free culture media for 48 h ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The following morning cells were plated on poly-L-lysine coated (R&D systems, Minneapolis, MN) coverslips in 24-well plates at 50,000 cells per well and returned to the incubator for 24 hours ...
-
bioRxiv - Bioengineering 2021Quote: ... basal media samples were collected for quantification of soluble CCSP via a premade Magnetic Luminex Performance Assay kit (Uteroglobin/SCGB1A1, R&D Systems). Culture media was collected from the bottom chamber of each tissue device and immediately frozen at −20°C until use ...
-
bioRxiv - Cancer Biology 2019Quote: ... media was removed from astrocytes and levels of cytokines were measured using the Rat XL Cytokine Array Kit (R&D Systems ARY030) using 1 mL of conditioned media per membrane ...
-
bioRxiv - Pathology 2019Quote: Analysis of the cytokine proteome was completed using a Mouse XL Cytokine Array Kit (R&D Systems, Bio-Techne Corporation, MN, USA). Gingiva and alveolar bone samples were individually pooled ...
-
bioRxiv - Cell Biology 2020Quote: Plasma samples from 22 ZZ-AATD and 21 non-AATD controls were analyzed for CX3CL1/ Fractalkine using Duoset kit (R&D systems, Minneapolis ...
-
bioRxiv - Bioengineering 2020Quote: The relative cytokine content of the decellularized mouse heart tissues (n=3) were obtained using the Mouse XL Cytokine Array Kit (ARY028, R&D Systems). Briefly ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... and the supernatant was used for the quantification of IL-1β e IL-6 cytokines using commercial kits (R&D System®).
-
bioRxiv - Cell Biology 2021Quote: Cytokine array was carried out in the young and aged L-MSC culture media using Proteome Profiler Mouse XL Cytokine Array kit (R&D Systems) as per manufacturer ‘s instructions.
-
bioRxiv - Neuroscience 2022Quote: Plasma cortisol levels were determined using the Cortisol Parameter Assay Kit according to the manufacturer’s recommendations (R&D Systems, Minneapolis, Minnesota, USA) (sensitivity 0.071 ng/mL ...
-
bioRxiv - Bioengineering 2023Quote: Cytokine profiling of the MBVs isolated from the aged and young mouse breast ECMs was performed using the dot blot-based Proteome Profiler Mouse XL Cytokine Antibody Array kit (R&D Systems) following the manufacturer’s instructions ...
-
Beclin1-Deficient Adipocytes Promote Tumor Progression by YAP/TAZ-dependent Adipocyte TransformationbioRxiv - Biochemistry 2023Quote: ... The levels of adipokines in the plasma of WT and BaKO mice were measured using the Mouse Adipokine Array Kit (ARY013; R&D Systems) and LEGENDplex (740929 ...
-
bioRxiv - Immunology 2023Quote: ... Total TGF-β levels were determined by acid activation of the latent TGF-β1 in the sample using the sample activation kit 1 (DY010) (R&D Systems).