Labshake search
Citations for R&D Systems :
2351 - 2400 of 2812 citations for Primary Human Cell since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... TET2 knock-in T-cells were incubated with a Cetuximab biosimilar (R&D Systems, #MAB9577) at a concentration of 2000 ng/mL for 20 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: MEG-01 cells were incubated with pan-Caspase inhibitor Z-VAD-FMK (R&D Systems) up to a concentration of 10 μM ...
-
bioRxiv - Cell Biology 2023Quote: Apoptosis of tumor cells was determined with an Annexin-FITC staining kit (R&D Systems) as per the manufacturer’s instructions and analyzed by flow cytometry ...
-
bioRxiv - Cell Biology 2020Quote: ... mOSE cells were plated 24hrs prior to the addition of TGFB1 (10ng/mL, R&D Systems) and cells were collected after 4 days of treatment ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were incubated over night at 4 °C with the anti-CD140a (R&D Systems AF1062) diluted 1:80 in blocking solution ...
-
bioRxiv - Immunology 2021Quote: ... Levels of IL-1β or TNF in cell supernatants were quantified by ELISA (R&D Systems).
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Neuroscience 2020Quote: ... cell media included RPMI-1640 Glutamax (Life-Technologies) supplemented with 10% FBS (R&D Systems/biotechne), 1% penicillin/streptomycin (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... The level of IL-1β in cell culture supernatants was measured using ELISA (R&D systems) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated with an anti-Nluc antibody (R&D systems, MAB100261-SP, mouse, 1:500) in 1 % BSA/DPBS for 1 h at 4 °C ...
-
bioRxiv - Immunology 2022Quote: ... cells were cultured with Areg (R&D Systems, #989-AR-100, 10 or 100 ng/ml) or heptelidic acid (Adipogen ...
-
bioRxiv - Immunology 2022Quote: ... Non-pathogenic Th17 cell differentiation was performed with IL-6 (25 ng/mL, R&D Systems) and TGF-β1 (2 ng/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... HEK 293T cells were seeded on plates coated with Cultrex Poly-L-Lysine (R&D Systems) prior to transfection with the pCCl-c-MNDU3 STEAP1-BBζ CAR lentiviral plasmid and the packaging plasmids pMDL ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were changed into fresh media supplemented with DMSO or 600ng/mL IFNγ (R&D Systems) and incubated for 48 hours ...
-
bioRxiv - Immunology 2021Quote: ... the INS-1 cells were treated with recombinant mouse IFNγ (1000 units/mL; R&D Systems) and recombinant human IL-1β (50 units/mL ...
-
bioRxiv - Neuroscience 2020Quote: Mouse myelogenous leukemia (M-NFS-60) cells were M-CSF (R&D systems, 216-MC/CF) starved for 24 hours ...
-
bioRxiv - Neuroscience 2021Quote: ... Sox2 was used as a neuronal stem cell marker (mouse, MAB2018, R&D Systems, 1:100), Tuj1 (mouse ...
-
bioRxiv - Microbiology 2020Quote: ... Cells or organoids were stimulated with IFN-α2 (500 U/ml, R&D systems 11100-1), IFN-β (500 U/ml ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were then fixed and immunolabeled using goat anti-Lumican (R&D Systems, AF2745, 1:200) and donkey anti-goat IgG Alexa555 (Invitrogen ...
-
bioRxiv - Pathology 2021Quote: ... the cells were incubated with an anti-myosin heavy chain (MHC) (#MAB4470, R&D Systems,MN) (1:100 ...
-
bioRxiv - Microbiology 2021Quote: ... The cells were stimulated with increasing amounts of IFNs (α2 (R&D Systems, Cat#11101-2), β (R&D Systems ...
-
bioRxiv - Cell Biology 2021Quote: ... placental cell clusters were pretreated for 30 min with anti-NRP1 mAb (R&D Systems, AF3870) or anti-ACE2 mAb (Agilent ...
-
bioRxiv - Immunology 2021Quote: ... and IL-1ß in the cell-culture supernatants were measured by ELISA (DIF50; R&D Systems) and using bead-based immunoassay (740929 ...
-
bioRxiv - Immunology 2021Quote: ... Th0 cell cultures were provided IL-2 (15 U/mL; R&D Systems 202-IL-500), while Th17 cell cultures were supplemented with IL-6 (20 ng/mL ...
-
bioRxiv - Immunology 2021Quote: ... nitrite concentrations in cell culture supernatant were determined via Griess reaction assay kit (R&D Systems).
-
bioRxiv - Immunology 2021Quote: ... Cells were treated with 10 ng/ml recombinant mouse TNFα (410-TRNC-010, R&D Systems) diluted in the media as described above.
-
bioRxiv - Microbiology 2020Quote: ... Detached cells were labelled with a mouse anti-ACE2 antibody (R&D Systems, Minneapolis, MN1/200) followed by an Alexa488 goat anti-mouse (1:1,000 ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were transferred to a new plate with fresh medium and IL-23 (R&D Systems). After 48 hours rest ...
-
bioRxiv - Cancer Biology 2022Quote: ... Slides were processed with a commercial DAB cell and tissue staining kit (#CTS019, R&D Systems). Primary antibody immunostaining was optimised for polyclonal rabbit anti-human peroxidasin (#abx101905 ...
-
bioRxiv - Cell Biology 2022Quote: ... specifically: goat anti-mouse platelet-endothelial cell adhesion molecule-1 (PECAM-1)/CD31 (R&D Systems), mouse anti-mouse α-smooth muscle actin (αSMA ...
-
bioRxiv - Neuroscience 2022Quote: ... cell lysates (100 μg of protein) were incubated with O-GlcNAcase (5 μg, R&D Systems) at 37°C for 2 h.
-
bioRxiv - Cancer Biology 2023Quote: ... cells were harvested and lysed by lysis buffer provided in the kit (R&D Systems, #895943). The supernatant was collected after centrifugation at 14,000xg for 5 min at 4°C ...
-
bioRxiv - Microbiology 2023Quote: Cytokine analysis of host cell culture supernatants was performed using DuoSet ELISA kits (R&D Systems) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell pellets were resuspended in 70% basement membrane extract (BME) (R&D Systems, #3533-010-02). Each droplet of cell clusters contained roughly ∼2,000 cells/ 50uL ...
-
bioRxiv - Immunology 2023Quote: ... The cell monolayer was then stimulated with 6.25U/mL IL-1β (R&D systems, Minneapolis, MN) for 4h at RT to upregulate E-selectin ...
-
bioRxiv - Bioengineering 2023Quote: ... B cell activating medium was supplemented with 5 ug/mL anti-CD40 antibody (R&D systems) and 20 ng/mL IL-4 (R&D Systems ...
-
bioRxiv - Cell Biology 2023Quote: ... single cell suspensions were stained with a goat anti-galectin-9 antibody (AF2045, R&D systems) at 40 μg/ml or isotype control as negative control for 30 min at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell lysates were then incubated with 2 μg of anti-galectin-9 (AF2545, R&D systems) or isotype control under rotation ...
-
bioRxiv - Cell Biology 2023Quote: ... 20 ng/mL glial cell line-derived neurotrophic factor (GDNF; R&D systems, catalog #: 212-GD), and 10 µM ROCK inhibitor Y27632 (HelloBio ...
-
bioRxiv - Cell Biology 2023Quote: ... Those cells were washed and subsequently resuspended in Cultrex BME (Cat. No. 343300501, R&D Systems) and plated in 20-25 µl droplets of Cultrex ...
-
bioRxiv - Immunology 2023Quote: ... single cell suspensions were stained with a goat anti-galectin-9 antibody (AF2045, R&D systems) at 8 μg/ml or isotype control as negative control for 30 min at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were treated with or without 10 ng/ml TGFβ (R&D Systems, Cat. # 240-B) for another 24 hr and harvested for RNA extraction after 72 hr.
-
bioRxiv - Neuroscience 2024Quote: ... and 2 ng/ml glial cell-derived neurotrophic factor (GDNF, R&D Systems, Minneapolis, MN, USA). The experiments were conducted on flasks or multi-well plates (Nunc ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells in PBS were mixed 1:1 with Cultrex TM (R&D systems, Minneapolis, MN, USA) at a final concentration of 1 x 106 in 100 μl prior to injection ...
-
bioRxiv - Cell Biology 2020Quote: ... After 4 days cells were re-stimulated and cytokine production was measured by ELISA (R&D Systems).
-
bioRxiv - Cell Biology 2020Quote: ... cells were cultured in the presence of M-CSF (30 ng / mL; R&D Systems, Minneapolis, USA), and with RANKL (10 ng / mL ...
-
bioRxiv - Immunology 2021Quote: ... the cells were stimulated with either 1 µg/ml recombinant murine CXCL13 (CXCL13, R&D Systems; Biotechne), 10 µg/ml AffiniPure F(ab’)2 fragment goat anti-mouse IgM (anti-IgM ...
-
bioRxiv - Developmental Biology 2021Quote: ... or snapshot acquisition after cell synchronization in metaphase using 60μM proTAME (R&D systems, #I-440-01M) and 200μM Apcin (R&D systems ...
-
bioRxiv - Cell Biology 2022Quote: ... stromal cells were incubated with phycoerythrin (PE)-conjugated anti-CD140b antibody (R&D Systems, Minneapolis, MN, USA) for 45 mins at 4°C followed by another 15 mins incubation with anti-mouse IgG1 magnetic microbeads (Miltenyi Biotech) ...
-
bioRxiv - Immunology 2022Quote: ... CFSE-labelled cells were then resuspended in R10 media supplemented with recombinant IL-2 (R&D system) and 2-mercaptoethanol (Themo Fisher Scientific ...