Labshake search
Citations for R&D Systems :
9301 - 9350 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... goat anti-Isl1 (R&D systems AF1837, 1:100), mouse anti-Nr2e3 (R&D systems PP-H7223,1:100) ...
-
bioRxiv - Developmental Biology 2020Quote: ... goat anti-Otx2 (Af1979, R&D Systems,1:400), and mouse IgG2b anti-HNF-6 (sc-376308 ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti-ESRRB 1:200 (R&D Systems H6707), and Phalloidin 1:500 (Thermo Scientific A12380).
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-Nkx2-5 (25 μg/ml, R&D Systems, #259416), rabbit anti-MYL7 (1:1000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3μM CHIR99021 and 20ng/ml Activin A (R&D Systems), which was changed every 2 days ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sox17 [AF1924 lot (R&D Systems)] ...
-
bioRxiv - Developmental Biology 2020Quote: ... 10 ng/ml GDNF (R&D Systems), 1 μM dibutyryl-cyclic AMP (dbcAMP).
-
bioRxiv - Developmental Biology 2020Quote: ... 40 ng/ml FGF8 (R&D Systems), 2 μM CHIR 99021 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 40 ng/ml basic fibroblast growth factor bFGF/FGF2 (R&D Systems). N2B27 basal medium ...
-
bioRxiv - Developmental Biology 2020Quote: ... 2 ng/ml HGF (R&D Systems) and 50 μM Y-27632 (Tocris Bioscience) ...
-
bioRxiv - Genomics 2020Quote: ... Polyclonal goat anti-ACE2 antibody (R&D Systems #AF933) was applied overnight at 40C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Undifferentiated cells were cultured at 33 °C in the presence of 10U/mL murine IFN-gamma (R&D systems). To induce podocyte differentiation cells were shifted to 37 °C for 14 days in the absence of IFN-gamma.
-
bioRxiv - Molecular Biology 2020Quote: ... and further differentiation was promoted by FGF9 (R&D systems) and transient treatment of CHIR (Tocris) ...
-
bioRxiv - Neuroscience 2020Quote: ... and goat anti-platelet derived growth factor receptor-alpha (PDGFRα, R&D systems #AF1062, 1:200), in a PBS-based diluent buffer containing 10% normal donkey serum and 0.2% Triton-X100 ...
-
bioRxiv - Neuroscience 2020Quote: ... and Sox9 (RRID:AB_2194160,1:200, R&D system, AF3075).
-
bioRxiv - Neuroscience 2020Quote: ... PDGFRa (RRID:AB_2236897,1:200, R&D system, AF1062), SMI32 (RRID:AB_2314912 ...
-
bioRxiv - Molecular Biology 2020Quote: ... the quantity of IL-2 released by Jurkat-CD16 cells was measured in the cell supernatant by colorimetry using a human IL-2 DuoSet ELISA DY202-05 Kit (R&D Systems, Minneapolis, MN, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... and BMP-10 were obtained from R&D Systems, PROMOCELL or produced in-house ...
-
bioRxiv - Neuroscience 2020Quote: ... the cells were incubated with monoclonal anti-neuron-specific beta-III tubulin (Tuj-1, MAB1195 R&D Systems), rabbit polyclonal astrocyte-specific anti-glial fibrillary acidic protein (GFAP ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 ng/ml bFGF (R&D Systems), N2 supplement (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... PF-543 hydrochloride (5754) from R&D Systems; ABC294640 (10587 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mycoplasma testing was performed every 3 months with the MycoProbe mycoplasma detection kit from R&D systems (Minneapolis, MN). None of the cell lines used in this study are found on the misidentified cell lines list from the International Cell Line Authentication Committee.
-
bioRxiv - Molecular Biology 2020Quote: ... 250 ng/uL murine R-spondin (R&D Systems, cat. 3474-RS-050), and 10 mM Y27632 (Enzo Life Sciences ...
-
bioRxiv - Molecular Biology 2020Quote: ... or polyclonal rabbit IgG (R&D Systems, AB-105-C). In all analyses ...
-
bioRxiv - Molecular Biology 2020Quote: Adiponectin levels in the gonadal white adipose tissue was determined using Quantikine mouse adiponectin/Acrp 30 ELISA kit from R&D systems (MN, USA). Liver homogenates were measured by a solid-phase ELISA technique according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: FGF-21 levels in the serum and liver were determined using Quantikine mouse/rat FGF-21 ELISA kit from R&D systems (MN, USA). Serum and liver homogenates were measured by a solid-phase ELISA technique according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: IGF-1 levels in the serum and tissues (liver, gastrocnemius, and brain cortex) were determined using Quantikine mouse IGF-1 immunoassay from R&D systems (MN, USA). Serum samples were diluted in calibrator diluent provided in the kit at 500-fold dilution and assayed according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and then incubated with a primary TREM2 antibody (TREM2 Ab MAB1828: R&D Systems) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were stained using the Mouse Mesenchymal Marker Antibody Panel (R&D Systems). Primary antibodies were added to cells at a concentration of 1 μg/ml diluted in Blocking Buffer and incubated at room temperature for 1 hour on a rocker ...
-
bioRxiv - Molecular Biology 2020Quote: ... anti-CD81 (1:600, R&D Systems, MAB4615), anti-Calnexin (1:1000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... FGF-2 in the CM was assayed using a human FGF basic DuoSet ELISA Development Kit (R&D Systems) according to the manufacturer’s procedure.
-
bioRxiv - Molecular Biology 2020Quote: ... and TNF-α-treated CM with FGF-2 neutralizing antibody (NAb; AF-233, R&D Systems). On day 7 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 50 ng/mL EGF (R&D Systems, Minneapolis, MN, cat.2028-EG), 100 ug/mL Noggin (PeproTech ...
-
bioRxiv - Neuroscience 2020Quote: ... 20 ng/ml rhFGF2 (R&D Systems), 20 ng/ml rhPDGF-AA (R&D Systems) ...
-
bioRxiv - Neuroscience 2020Quote: ... NMPM: N2B27 supplemented with 40 ng/ml recombinant human (rh) FGF2 (R&D Systems), 40 ng/ml rhFGF8 (R&D Systems) ...
-
bioRxiv - Neuroscience 2020Quote: ... 20 ng/ml rhPDGF-AA (R&D Systems), 60 ng/ml tri-iodothyronine (T3 ...
-
bioRxiv - Neuroscience 2020Quote: ... OPCM: N2B27 (no Vitamin A) supplemented with 10 ng/ml rhIGF-1 (R&D Systems), 20 ng/ml rhFGF2 (R&D Systems) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were labeled with IgM PE-O4 antibody (R&D Systems FAB1326P) at 10 μl/106 cells ...
-
bioRxiv - Neuroscience 2020Quote: ... We added 10 ng/ml soluble rhBDNF and rhGDNF (R&D Systems) to the culturing medium on days of TDM media changes ...
-
bioRxiv - Neuroscience 2020Quote: ... 40 ng/ml rhFGF8 (R&D Systems), 2 μM CHIR99021 (Tocris Bioscience) ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μg/mL mouse R-spondin (R&D systems), 100 ng/mL Noggin (Peprotech) ...
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Genomics 2020Quote: ... LDLR staining was performed for 30 min on ice with a 1:50 dilution of AlexaFluor488-conjugated LDLR antibody (R&D Systems, Minneapolois MN, FAB2148G) into PBS supplemented with 1% FBS ...
-
Pancreatic progenitor epigenome maps prioritize type 2 diabetes risk genes with roles in developmentbioRxiv - Genomics 2020Quote: ... and human EGF were purchased from R&D systems. Other added components included FBS (HyClone) ...
-
bioRxiv - Genomics 2020Quote: ... PE-conjugated anti-KDR (R&D Systems), PECy7-conjugated antiCD31 (BioLegend) ...
-
bioRxiv - Microbiology 2020Quote: ... GM-CSF and IL-3 [all from R&D Systems]) ...
-
bioRxiv - Neuroscience 2020Quote: ... Mice were administered either a 5 μL volume of phosphate-buffered saline (PBS) containing 10 μg/kg of carrier-free rmIL-1β (R&D Systems, Minneapolis, MN) or PBS alone (control ...
-
bioRxiv - Neuroscience 2020Quote: ... in DMEM/F-12 and plated into either 60 mm or 100 mm tissue culture dishes as described above with the addition of rmIL-1α or rmIL-1β (50 or 500 pg/mL, R&D Systems, Minneapolis, MN)) for treatment groups ...
-
bioRxiv - Genomics 2020Quote: ... goat anti-SOX17 (1:300 dilution, R&D systems); goat anti-HNF4A (1:1000 dilution ...
-
bioRxiv - Genomics 2020Quote: ... and human EGF were purchased from R&D systems. Other added components included FBS (HyClone) ...