Labshake search
Citations for Santa Cruz :
601 - 650 of 7673 citations for 8 Chloro 2 methylimidazol 1 2 a pyrazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... cells were cultivated four days in the presence of 2.5 μM D-threo-l-phenyl-2-palmitoylarmino-3-morpholino-l-propanol (PPMP; Santa Cruz) to inhibit synthesis of glucosylceramide-based GSLs [41].
-
bioRxiv - Biochemistry 2022Quote: ... while actin was labeled with the C-2 mouse mAb (both from Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA). As a secondary antibody ...
-
bioRxiv - Microbiology 2023Quote: ... Phage lysates were treated for 2 hr at 37°C either with 0.01 M methyl methanesulfonate (MMS) (Santa Cruz Biotechnology) or equal volume of phage buffer (100 μM Tris pH 7.5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... media was removed and cells incubated with 20 mL of PBS containing 2 mM disuccinimidyl glutarate (DSG) (Santa Cruz Chemical) for 20 minutes at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... CARD9 mouse monoclonal Ab (Santa Cruz Biotechnology, A-8: sc-374569), MALT1 mouse monoclonal Ab (Santa Cruz Biotechnology ...
-
bioRxiv - Biochemistry 2019Quote: ... and proteins bound to monoclonal anti-PLCβ1a (Santa Cruz, D-8) were separated by electrophoresis ...
-
bioRxiv - Cell Biology 2019Quote: ... The PACRG mouse C-8 monoclonal antibody was from Santa Cruz Biotechnology (# sc-373851) ...
-
bioRxiv - Cancer Biology 2022Quote: ... mouse anti-p27 (F-8) monoclonal antibody (Santa Cruz, #sc-1641) 1:200 ...
-
bioRxiv - Cell Biology 2023Quote: ... or PPAR-γ Antibody (E-8) (Santa Cruz, Cat# sc-7273) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... then soaking the gel for 2 hr with shaking in 1X TBE supplemented with 4.5 mg/mL chloroquine phosphate (Santa Cruz Biotech). The gel was then turned 90° and electrophoresed in the orthogonal direction at 130 V for 60 min in 1X TBE supplemented with 4.5 mg/mL chloroquine phosphate ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mg protein extract was used for immunoprecipitation and incubated with protein G beads and 4 μg mouse anti-GFP antibody (B-2 #sc-9996, Santa Cruz). Western blotting (Fig ...
-
bioRxiv - Immunology 2019Quote: ... and Homology Directed Repair plasmids containing puromycin resistance gene (MAVS: sc-400769-HDR-2, RIG-I: sc-400812-HDR, both Santa Cruz). The knockout plasmids are a mixture of three plasmids ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were plated in 48-well plates (2×105 cells/well in 600μL) and mixed with polybrene (Santa Cruz Biotechnology, 134220) to a final concentration of 4μg/mL and 100-200μL undiluted lentiviral supernatant ...
-
bioRxiv - Biochemistry 2020Quote: ... GβL (sc-425272) and SUMO1/2/3 deletion were carried out in striatal cells using CRISPR/Cas-9 tools obtained from Santa Cruz, as described before [46 ...
-
bioRxiv - Microbiology 2022Quote: ... The membrane was blocked with 5% milk/PBS for 2 h before incubation with mouse monoclonal anti-HA antibody (Sc-7392, Santa Cruz) at 1:10,000 for overnight at 4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Respective cells were incubated with anti-c-Myc antibody (9E10, mouse monoclonal, 2 mg/ml; Santa Cruz Biotechnology, Dallas, TX, USA) for 1 h at room temperature ...
-
bioRxiv - Pathology 2020Quote: ... Transfected cells were selected by selection media containing 2 μg/ml puromycin dihydrochloride (cat. no. sc-108071; Santa Cruz Biotechnology, Inc.). After confirming the decrease in LOXL2 expression by reverse transcription-quantitative polymerase chain reaction (RT-qPCR ...
-
bioRxiv - Pathology 2020Quote: ... HK-2 cells were treated with media containing 5 μg/ml of polybrene (cat. no. sc-134220; Santa Cruz Biotechnology, Inc.), and then LOXL2 shRNA lentiviral particles and control shRNA lentiviral particles of 1 and 2 multiplicity of infection (MOI ...
-
bioRxiv - Genetics 2019Quote: ... then incubated in primary antibody in 1% (w/v) skimmed milk in PBS at the following concentrations for 2-20 h at 4°C (anti-Srs2, Santa Cruz sc-1191 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... the mem branes were incubated for 2 h at 37 °C with peroxidase conjugated secondary antibodies against r abbit IgG (Santa Cruz Biotechnology ...
-
bioRxiv - Immunology 2020Quote: Human T cells (2-5 x 106) were transfected with 3 μg of TERT KO CRISPR/Cas9 plasmid (h) (sc-400316, Santa Cruz) according to the manufacturer instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... for EGFP-tagged Vpu/F1/F2 detection, Nef antibody (EEH1, NIH AIDS Reagent Program) and anti-HA antibody for HA-tagged BST-2 protein (Santa Cruz). Secondary antibodies conjugated to HRP (Calbiochem ...
-
bioRxiv - Cell Biology 2021Quote: ... INSR was immunoprecipitated by incubating 500 μg of protein lysate with 2 μg INSR antibodies (Rabbit pAb, Cat. #sc-711, Santa Cruz) at 4°C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pre-cleared chromatin was incubated with 2μg anti-Survivin (Tang, Ling, et al (2012) BBRC 421(2) 249-254) (10811, Santa Cruz Biotechnology), anti-H3K27ac (C15410196 ...
-
bioRxiv - Biophysics 2022Quote: Transcription induction of the transfected construct was done 24 h after transfection using 2 μg/mL doxycycline (Santa Cruz # sc-204734B) in Tet-free medium ...
-
bioRxiv - Cell Biology 2022Quote: ... sc-17787), rabbit polyclonal anti-HDAC6 (sc-11420), and mouse monoclonal anti-GFP (B-2, sc-9996) were obtained from Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2023Quote: ... 3mg of nuclear lysates were used for IP with 2 μg IgG or 5 μg primary antibodies (normal mouse IgG, Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transcription factor ChIP-Seq was performed as previously described11 with 2-5 ug of antibody was used per immunoprecipitation (POU2F2, sc-233X, Santa Cruz; POU2AF1 ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSC-CMs were resuspended in replating media (RPMI plus B27 supplement with 2% FBS and 5µM Y-27632 (Santa Cruz Biotechnology)) and 125,000 cells were seeded per fibroTUG substrate through the top of the cell seeding mask in approximately 200 µL of media ...
-
bioRxiv - Molecular Biology 2023Quote: ... All samples and standards had a heavy isotope-labeled nucleoside mix added prior to mass spectral analysis (2′-deoxycytidine-13C1, 15N2 (Cat# SC-214045, Santa Cruz), 5-(methyl-2H3)-2′-deoxycytidine (Cat# SC-217100 ...
-
bioRxiv - Molecular Biology 2024Quote: ... All samples and standards had a heavy isotope-labeled nucleoside mix added prior to mass spectral analysis (2′-deoxycytidine-13C1, 15N2 (#SC-214045, Santa Cruz), 5-(methyl-2H3)-2′-deoxycytidine (#SC-217100 ...
-
bioRxiv - Neuroscience 2024Quote: ... SMAD and Wnt inhibition were discontinued after D3 and the neurons were matured with daily medium changes involving 10µM N-[2S-(3,5-difluorophenyl)acetyl]-L-alanyl-2-phenyl-1,1-dimethylethyl ester-glycine (DAPT; Santa Cruz Biotechnology, SC-201315A), neurotrophic factors (brain-derived neurotrophic factor (BDNF ...
-
bioRxiv - Cancer Biology 2021Quote: ... Transduction was conducted in 6 well format on 1 × 105 cells and cells plated in suspension into viral supernatant containing 8 μg/ml Polybrene (Santa Cruz Biotechnology: SC-134220) and incubated overnight (16h) ...
-
bioRxiv - Cell Biology 2020Quote: ... and for Sirt1KO with 2 Double Nickase plasmids each containing a different sgRNA to target sequences 148 CGGACGAGCCGCTCCGCAAG and 110 CCATGGCGGCCGCCGCGGAA (Santa Cruz Biotechnology). For control cells ...
-
bioRxiv - Genetics 2019Quote: ... Proteins were separated by SDS-PAGE and detected via Western blot following blocking (in TBS-0.1% Tween-20 with 5% non-fat milk powder) with the following antibody dilutions in the same blocking solution: α-GFP-HRP (B-2, sc-9996, Santa Cruz), 1:5000 ...
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... was used to collect leaf discs from the inoculation sites three weeks after PVX inoculation for immunoblot with anti-GFP (B-2, sc9996 HRP, Santa Cruz Biotechnology). GFP accumulation was visualised with Pierce™ ECL Western (32106 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 mg of lysate were incubated overnight with 2 μg of anti-HA-tag or control mouse IgG antibody (sc-2025, Santa Cruz Biotechnology) at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was incubated for 1h at room temperature in blocking buffer (5% nonfat milk in PBS pH 7.4 containing 0.1% Triton X-100 and 0.02% NaN3) and immunoblotted for 2 h at room temperature with antibodies raised against insulin (Santa Cruz Biotechnology Inc, Santa Cruz, CA), the porosome associated protein ATP2C1 and actin (Santa Cruz Biotechnology Inc ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 2.2) for two times and applied for the immunodetection of phosphorylation levels by using an anti-pSer primary antibody (Santa Cruz, USA) and antimouse secondary antibody (Santa Cruz ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by secondary antibodies tagged with Alexa Fluor® 488 or Alexa Fluor® 568 at room temperature for 30 minutes and 4,6-diamidino-2-phenylindole (Santa Cruz). All samples were assessed under a fluorescence microscope (Leica Microsystem ...
-
bioRxiv - Cell Biology 2021Quote: ... The SCG section was incubated with the mouse monoclonal anti-TIGAR (E-2) Alexa Fluor 488 (sc-166290 AF488, Santa Cruz Biotechnology) and Goat polyclonal anti-VChAT (Cat# 24286 ...
-
bioRxiv - Immunology 2022Quote: ... Blotted proteins were detected with a rabbit polyclonal antibody that recognizes SARS-CoV-2 spike RBD (40592-T62, SinoBiological) and a donkey anti-rabbit IgG-HRP antibody (sc-2077, Santa Cruz Biotechnology).
-
bioRxiv - Cell Biology 2022Quote: ... The following antibodies were used: anti–pERK1/2 (E-4; sc-7383) and anti– β-actin (C4; sc-47778) from Santa Cruz Biotechnology ...
-
Stem cell-derived macrophages as a new platform for studying host-pathogen interactions in livestockbioRxiv - Immunology 2021Quote: ... and the cells were transduced with lentivirus (250 μl/cm2) in Macrophage Maturation Medium containing 2 μg/ml Polybrene (Santa Cruz, sc134220) by spinfection (centrifugation at 1000 x g for 1 h at 32°C) ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were treated with 20 ng/ml IL-6 and 4 hours post-treatment lysed using CHAPS buffer and incubated overnight with 2 μg of an anti-ETV7 antibody (TEL2, Santa Cruz Biotechnologies) or normal mouse IgG (Santa Cruz Biotechnologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... and rotated at 4°C overnight with 2-5 ug of antibody (H3K27ac, Active Motif Cat #39133; V5 tag, ThermoFisher #R960-25; ETV6, Santa Cruz, # sc-166835x ...
-
bioRxiv - Molecular Biology 2022Quote: ... The membrane was incubated in blocking buffer (Amersham Biosciences) for 60 minutes at room temperature and in primary antibody (BRF1/2: CST#2119, GR: CST#3660, GAPDH: Santa Cruz sc32233) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ATDC5 and SaOS-2 cells were transfected with the mouse or human SHIP2 double nickase plasmid (Santa Cruz, sc-421138-NIC (mouse), sc-401622-NIC (human) ...
-
bioRxiv - Genomics 2023Quote: ... Samples were pre-cleaned by incubating with 2–4 μg of normal immunoglobulin G (IgG) and 50 μl of A / G-agarose protein microspheres (Santa Cruz Biotechnology) for 1 hour at 4 °C with agitation for preclearance ...
-
bioRxiv - Bioengineering 2023Quote: ... Alomone Labs) or 5 µM of antibodies for targeting neurons with dopamine receptor 2 (D2R) (anti-D2DR, sc-5303, Santa Cruz Biotechnology) or without cell type specificity (rabbit anti-human IgG ...